GenePrediction:GLEAN_215 Details

Name: GLEAN_215
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:315032..315861 (+ strand)
Length: 830
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:315032..315089 (+ strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_167:315143..315182 (+ strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_167:315240..315256 (+ strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_167:315335..315861 (+ strand)
Length: 527
>GLEAN_215 class=GenePrediction position=GCSC_167:315032..315861 (+ strand)
ATGGCATCATTCGCAGACCTCGGCCAGCTGGTCGACTTCAATCAGACAAGCCTCTACTGTAAGCAGCCCCTCCTTCGGTC
CCGAGCTTCTTCCAACAACTGACGGCTGTAGTTTCTGTCCTGGCCATCGTATTCAACCCGACCTTTTGGAAGTAAGTTTG
TCCTTCGTGCTGGCAAGTTTTTCGTTTGTTCTTTGACTGACTGGCCAGCATCGTGGCGAGAAAGGGTACGGCCTACACCT
TCATCCATCCGCTTTTCCACTGTACATTTCAAGCTTCCAGACACTCCCTGCTAACTGTCCCAGAATACCGCACGCACTTC
CTGACCCGGCTCTTCGGCGGCCGTGCCCGCACCGCCTGCTACTTCCTTGCAGCCACCATCTTCTCGCTCGGCATCGTGCG
CGACCTGCTCTACGAGCGTGCCTTGCGCCACCAGCCCACACATCCGCTGCTGGCCGCACCCAAAGTTGCCTACGGCGGCT
ATGCACTGCTCGCCCTCGGTAACGTGCTCGTGGTCTCGTCGACGTGGCGCCTCGGCATCACTGGCACCTTCCTGGGCGAC
TACTTTGGCATCCTGCTCGACAGCATGGTCACTGGCTTCCCCTTCAACGTCACCGATGCTCCTATGTACTACGGCAGCAC
CATGAGCTTCCTTGGTTCCGCCTTGGTCTACGGCCGGCCTGCTGGCGTGCTGCTGACTGTTGAGGTCCTGTTCGTCTACC
TGATCGCCCTCCGGCTGGAGAACCCCTTCACGGCCGGCATCTACGCCAAGCGGGAGGAAGAGCGCAGCAGGCAGGCTGCT
GTCAGCAAGGAGCCCAAGAAGCAGCGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62