GenePrediction:GLEAN_2161 Details

Name: GLEAN_2161
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1138861..1140912 (+ strand)
Length: 2052
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1138861..1138867 (+ strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_108:1138935..1139122 (+ strand)
Length: 188
Type: CDS
Source: GLEAN
Position: GCSC_108:1139185..1139448 (+ strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_108:1139504..1139709 (+ strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_108:1139762..1139817 (+ strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_108:1139873..1140912 (+ strand)
Length: 1040
>GLEAN_2161 class=GenePrediction position=GCSC_108:1138861..1140912 (+ strand)
ATGATGCGTGAGTAGCCTTATCGCTCTGCTCTCCTTTGTCCACAAGGATACGTGTTGCTCACTCTTTCCGCCAGGTCTCC
TATCTGTCCCCCGGGCCTGGCTTGTCCCGCTGCTGGCTCTCGAGGCACAGCTCGCTTTGGCACTGCCGGCACTGCAGCAG
CAGCAGCCCCTGCAGAGTGACGATGGTGTCAGTTCCAATGGCGCTGTGGCCTGCGAGAGCTCCATCTGCTCCAAGATTGG
CATCGACCTGATGCGAAGGGGGGTGCGTCCTCTTGCTTTTCGCTTTCCTTATACGCTTTTCACTCGCCTTTCTGACACCA
CCAGGGCAACGCTGCCGACGCCATGGTCGGCACCACCCTCTGCGTCGGCGTCATCGGCATGTATCACTCTGGCATTGGCG
GTGGCGGTTTCATGCTTGTCCGCAGTCCTGCCGGCGAGTACGAGGTCGTCGACTTCCGCGAAACTGCGCCCGCTGCTGCC
CACAAGCACATGTACGACGGCAACAACGAGGGCGCCCTGTTTGGTGGCTTGGCCGTCGCCATCCCGGGCGAGTTGCGCGG
CCTTGAGTACTTGCACCAGAAATACGGTGTGCGTCTGTTCTTTCCCTTTCCTTTCCTCTCCTCTCCTCTGCTGACACCTA
CAGTCGCTTCCGTGGGAGGTTGTCGTCACGCCGGCCGTCCACGTCGCCCGCGACGGTTTTCCCGTGTCCGAAGACCTGGT
CAAGTTCATGACCTACAATCCCGATACCGTCCGGCTCCTGGTCGAGGATCCCGTCTGGGCCCAGGACTTTGCCCCCAACG
GCACGCTGCTGCAGCTGGGCGACACCATCACCCGCGCACGCTATGCTGAGTAAACACTCTTGTCTCTGTGTTGCTGCCAG
AGCGAATGCTGACCTTGGCAGTACTCTAGAGCAGGTAGCGAAGCACGGGGCGGATGTGTTCTACAGCGGGCCGATTGGTA
CGTGTGTGTCTGTGTCTGTGTAGCCGTCTGTCTTCTCTTGCTGACAGGCCAGCCGAATCGATGGTCGAGGCCATCCAGGC
GAGCAACGGGACGGCCACGCTGGCCGACTTTGCCGGCTATGCGGCCATTGTGCGGGCGGCCGTGCAGGGCCAGTACCGAG
GCCGCCGGCTGTTTGCGACGGGTGCGCCGTCGTCGGGCGCCGTGACGCTGTCGGTCCTGCAGACGCTGGACGAGTATCCG
CGGCCGGACGCGACTGACGCGGCCGATGCTGATGCCGACACCAACGTGACGACGCACCGGTTCGACGAGGCCCTGCGCTT
TGGCTACGGCGCGCGCACGCATCTGGGCGACCCAGCCTACGTCGCCGGCGCAGCTGCCTACGAGGCTGCCATGCTCACGG
CAGCACACGCAGCCACGACGCGCCGGCAGATCCGTGACGACCGCACGCTGCCCGTCGCGGCTTACAACCCGGCCGGTTCG
TTTGCTTCGCCAAGTCACGGGACTAGTCACGTGTCCACGGCGGATCGCAGCGGTCTCGCCGTCAGCAGCACCACCACGAT
CAACACCATCTTCGGATCCCGCCTCATGGACGCGGCCTCGGGCGTGATCCTGAACAACGAGATGTGCGACTTCTCCATCC
CGGGCGCCCGCGACGCCTTTGGCTACCCGCCCAGCCCCGGCAACTACGCCCGTCCCGGCAAGCGACCGCTCAGCTCAACT
ACCCCCCTCATGGCCGAAGAGTGGGATCCGACCTCTGGCTCCTGGCGCCTCGCCCTCGTCACCGGCGCCGCGGGCGGTAG
CCGCATCATCTCTGCTACCGCCCAGGTCGTCTGGCACGTCCTCGAACACGGCCTCGGCATCGCTGCCGCCCTCGCTATGC
CCCGCCTCCACGATCAGCTCGCGCCCAACCAGGTCGTCTTCGAGGCCGCCTACGATAACCGCACCGTCACCGCCCTCGCT
GCCCGTGGCCACCATGTCGCCTGGACTGCCGAATATGCCAGCGCCGCCCAGGGAATCCAGATCTTGCCGGGCGGCCGCTT
CGACGCTGCCGGCGAGCCGCGCCAGAAGAACAGCGGTGGCGAGGTGTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62