GenePrediction:GLEAN_2162 Details

Name: GLEAN_2162
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1143596..1145124 (+ strand)
Length: 1529
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1143596..1143773 (+ strand)
Length: 178
Type: CDS
Source: GLEAN
Position: GCSC_108:1143845..1145124 (+ strand)
Length: 1280
>GLEAN_2162 class=GenePrediction position=GCSC_108:1143596..1145124 (+ strand)
ATGGCACGCAGGGTGTCCAAGCCACGCGCCGGCCGTTCTCGCCTTCATCTGTCCAGAGCCTGTCACGATGAAGCAGTACT
CGCCTCAAGCGTGTCGCTGACTACACGGCCAATCCATCTCGAGACCGAGTCGCTGTACGGCCGCCGGGACCAGCCGGTGT
CGACGGAAGGACGTCCGGGTAAATACCACCGTACCACGTCCTTTGTCAAACACACATACGTCTGCATGCTAACATGCATC
CCGGCCCAGTATCAAGGCGAAGCGAGCGACTGCAGGCACGACGTCAGCCTCTGGTAGAAACCTCCGACTCTCGCAGCGCT
ACGGCGGCACCACGCTTCACCGCCAGGTCTCCCCTGCATGGCGTGTCTTCTCTGGCCCTGCCAGTGCGCGTCAGTCTGAC
GGAGAACAACCTGAGACGATTCGATGCCATGACCCGGCCCAGAAGGCCGCCAGGGGACGAATGGCACCCTGCTTCTGCCA
TGGCAGCACCGCCTGTCAGGGACGACGCAAGAACAGCCGGGTCGAGGCAGTCCGACCCTGCGACCCCATCGACAAGCAGG
TTTGGACACCAGGCCAAGAACAACGGCGTGTTGGACCGCGTCCACTCCCAGCCGCCTGCCAACCTGGACAGCCTGCGCGA
GCAGCTCAACAGGACCCGACAGACAGCGTCGCCGACCGTGTCGCAGTATGAGGCCTACGTCTACGCCGTCGAGACCGCAC
CCAACGAGGCCACCATCGTGCACGAGACCACACGCCTGCTCAAGGAGTACGATGACCGTGGCTACCGCAAGGTGTTTAGC
CAGGCCTTCACGGCCTTTCCCGGCGATGTCGGCTTCAACGATGGCATGCCGGCCCCGCAGCCCGACATGGTAGAGGGCCT
CCAGCTGGACGAGTTCCACCCGTTTCCTGCCAGAGACGTGCTCGGCGGCGCGGCCGTCCTCTTCCGCGATCGGCCCTACT
CCATCACGCTGCCGCACTTGGCTGCCGAATGGAAGGGTCCCGGCAAGGACATGCTGCAGGCGAGGACTCAGAGCGCCTAC
AACGGCGCCGCCCTCGTCTACGGCCGGAACCAGGCCCTCGCCTTTCTGCGGGCCCGCGATCCTGCAGGCCAGGCGACCGT
CTGCACCTTCAGCACTGACGGTACCAACATCAACTTCAACGCCCACTTTGCCGCCCCGCGCTCGGGCAGGCCGCTGTCGG
GCGGCCAGACGACCGAGTACCACCAATATCCCATCGTCTCCACCAACCTGACCAACTCGTTTAGCGAGTTCAAGCGTGGC
CGGCGACAGCTTCGAAACCTGCAGGACGGTGCTCGCAAGGCGTCGTACGCATTGCGGGATCGCCTCCGACAGCATGGAGT
GGCAAGTGCTGAGTCGGGCGACGGGTTTGAGACAGAGCCTGTGGCCACCTCTTCGACGTCTAAATACGGCAGGGGACGGA
GACGGGGCCGTTCGGTGGCAGATGGGAGATCACAACGCACGTCAGATCGCTCGACCAGAAGGGGACGGTCAAGACGGAAA
CACCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62