GenePrediction:GLEAN_2163 Details

Name: GLEAN_2163
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1149732..1150352 (+ strand)
Length: 621
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1149732..1149742 (+ strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_108:1149845..1150352 (+ strand)
Length: 508
>GLEAN_2163 class=GenePrediction position=GCSC_108:1149732..1150352 (+ strand)
ATGGTTCCGAGGTCCGTCCCCCCCTTTCAGCCCACTGACCGTCTCTCGTACAATGCCCGCTGTACGCCCACCGTGATGTA
TTGCCGTTGTTGTCTGCTAAACGCCGAATCTAGCCTACCGGAAGATCGTAGTCTCGATGACAACATCTCGGCCACCGACG
ACGAAAAAACCCTTGTCAGTGCACCAATCAGTGAAAATGGCACTGCTCTCACCTCCAATCCTGCATCCGCCCACGTGCCT
GTCGAGCACATTCCTCTTAGCGACACTGGGTCTTCGCACTCCCCCACAAGCGAGGAGCGAAGCCTCATGAATAGTTCACA
GAGATCGATATCTGCGGCTGCTCGCCTCGCCATAGTAGATTTATTGGCCGAAGACGGGGAGAACGACCGCGCCCTCCGAG
AAGAACGTCTTCAGCTGTCACGGTCGGAGGAAGCACCATGGAGCCCATGGGTTCTATCTACACCAGAGGACCGTTTTCGA
CGTATTCAAGTGGTGCTTAAAAATAATGCCTTGCCTGTCAGGCACGATGTACCCGAGCCGGCGGCCGAGCATAGGCAAGA
AACGCTGCAATCTATTTCGTCATGTGCGACTGTCGAAATTATTGGTCTCACAAATGGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62