GenePrediction:GLEAN_2168 Details

Name: GLEAN_2168
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1189019..1194560 (+ strand)
Length: 5542
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1189019..1189169 (+ strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_108:1189259..1189582 (+ strand)
Length: 324
Type: CDS
Source: GLEAN
Position: GCSC_108:1189645..1193939 (+ strand)
Length: 4295
Type: CDS
Source: GLEAN
Position: GCSC_108:1193997..1194560 (+ strand)
Length: 564
>GLEAN_2168 class=GenePrediction position=GCSC_108:1189019..1194560 (+ strand)
ATGTCACCAGCTTCTTCCACGGGTGCGCCTCAGCGGCCTATGAGCGCAATGGTTCGTCCGGCTCCGAGAAGCAATAGTCG
CATGAGTGCTGGTAGCAAGACAGGTGGTAGCCGTGCTTCGGACGAAGACACACGCACGTCTGTCAAAGTCGGTACGTATA
TCCGGCTTCTGTCCTTCTTTCTTCCAGGCACCATGCTTTCGGCTGCGGACCGGGTGATTTTCCTTGGCTGACTGTTCCAG
TTGTTCGCGTGCGTCCGCCTCTGAAGCCTACCGACCCCGGCTACGATTTGATTCCCCAACGTTTTCAACGGTCCATGGTC
CATTTGATGTCCGACACGAGCCTGTCGATCGACTCACCACAAGGCCGCAAACTTTTTGTTTTTGACAGGGTTTTCGGTCC
CGAGGTGACGCAGAACGGCGTTTGGGAGTATCTGGACGACTCTGTTAATGCCTTCACCATGGGCTACAATGTCTCCCTTC
TTGCTTATGGCCAGTCTGGTGCTGGAAAGTCTTACACCATGGGAACATCTGGGCCGATAGACCAAGACAATCTGGAAATT
ATGGGTAGGGGCATACTCTTACTTCACATCACATGTAAAACATGTAATGCTAACTCACTTTGCTAGGCGTCATCCCGCGA
GCCGCTGCAGCGCTGTTCGAAAAGCTGGATGGCCCAAAAGGCACCACGAACCGCGCCTCGTTGTCCCATATGCGCGCTCC
CAGAGGCTACGGCCAGGCCGCCCCGAAAACAGACAAGACCTGGACTCTCATGGCGACGTATGTGGAGATCTACAACGAGC
AGCTTCGCGACCTACTACTTCCTGAGCATGTTCCGGTTCAGGAGCGCGCGAATGTCACAATTCGTGAAGATGTCAAAGGC
AACATCCTTCTCACGGGCCTCCACCAGGTAGAGATCTGCTCGGTTGAAGACCTCATGAACGCCCTCAACTTTGGATCTAC
TCTTCGCCAAACCGATGCTACCGCTATCAACGCCCGGTCGTCGCGGTCGCACGCCGTCTTCAGCTTGAACCTAGTCCAGC
GGAAAGCAGGCACCCCGGGAGCTAAGAACGAGAAACGGATGTCTGTTCCATTGGAAGCCATGTCAGGCACCGAATCCTGG
GTCACCATTGACAGCAAGCTCCATTTCGTTGATCTGGCCGGAAGTGAACGCCTGAAGAACACGGGAGCACAGGGCGAGCG
TGCCAGGGAGGGAATTTCTATCAATGCCGGCCTCGCAGCCCTTGGAAAGGTTATTTCCCAGCTTTCGTCTCGGCAGCCAG
GCGCCCACGTGTCCTACCGGGATTCCCGCTTGACTCGTTTGCTGCAGGATTCCTTGGGTGGCAATGCAATCACTTACATG
ATTGCGTGTGTTACCCCCCCGGAGTTTCATCTCAGCGAGACACTCAATACGGTGCAGTATGCACAGAGGGCCCGGGCGAT
CCAGAGCAAGCCACGGATCCAACAGGTTGAAGAGGGCGACAAACAGGCAATTATTGACCGCCTGAAGGCGGAGGTCGCCT
TTTTGCGAGAGCAGATTCGCAGCGCAGCTTCTGGAGGGACTAGTGGAGAACGGCGCGTACTATCAACAAATGAGCGTTCC
GATCGTCCAGGAGAACGGGAGGTGGAATTGCAGAACGCCCTACTGGATGCACAGGAAAACTACACCACCCTGAGCCAACG
ACACTCCCGACTCATTGCTGAGATGGCCAAAGCGCGAGACAACGAGGTGGCCGAGAATCAGCTCTTGCTTGATGCTGGGG
GTGACAGCGCGTCTGCACGATTAAACAGATCCAACAGCTTCGCCCAGGCAGTCGAGCAGGTCGTTTTAGAATACGAAAAG
ACGATTCAGTCACTGGAGCAGTCACTTTCCAGCACTCGGGCGACTCTTTCGGGTACAGAAACAAGCCTGTTGGAAAAGGA
AACGAAATGCGCCTACGTCGAGACCATCAATTCTCAGCTTCAGGCCCGGCTGCAGAAGCTCACGGACCGAGAAGCCACCA
CCGAGAACTATCTGCACGATCTCGAGTCCAAGCTGGACGGCCACACGTTCGGCGAGGAAAGAAATGCCACCATTGTCATC
GAGCTGCGCAAAGAAATCTCACGCATTCGCGAGAATGAGGCCACTTGCGAAGATTATATCTCCACCCTCGAAGAGCGCTT
AGCTGAAGCCGACCAAGACGCCGAACTGATGCAGCGTGAAATCGACCGCCTTGAACAGGTGGTCGAACGGCAACGCAGTC
TCGGCAAGCTCGACTCTCTCTTGTATGAACTCGATAACATGCAGCAGCAGGACGGCCGGTCCGAGACGCCTGCTGGTATG
GCCAGCGGTGCCGGTGCGATGGAAGACTCCGTGGCCAACGGCAACGGTATGGGCCATCGGCGCACCGCTAGCCGTAGCAT
CGCAGAGCACTCGCGCAGCCAGAGCCATGTCAGCCGTATGAGCCACAACACCGACGTCATTCCCGAGGAAGAAGACGATG
GATACGATGACAATTACGACAACGACAACGCCGCCGAGAACGAGAATGACGAGGTGGGGAATCAAACCTTCGGAGAGGCA
GAAGAAGCCGAAGATTCAGTTGAGGCACAGCTCTCTCGCTTGCCTCGTGGCGCTGCAGCACGTTCGGAAGGTCGTCTGAA
TAATTACCAGGATAGCCAAGCGCAGTCTAACTTTGTTTCTGACAAGTTGGAGTCGGTGAGCGAGGAGCTCGTTGGCTTGC
GTGTCGAGCATGAGGCGACTCTGAATGAGTTTGAGCTCCTTCAGGCTAAATACGAAAAGGCGCTGCGGACGCTTGCAGAG
TTGCAAGACTCGGTAGATGAATCCGGGCTCCCAAGGGATGTGGCGAGAGATTCGTTGGAGTCTGCGACCGACACAGCCCA
CACGGCACAAACAAGACCGTCGTCGTTCTTCTCCGATGCAAGGTCTAATGACGCAAAGAACGGGCGACACGTTTCGTCAA
CACGGTCACTCTCTTCTGAGCTGTCGTCAGCGATGGAGTCCCCGGCTACGGTTGACCATTCCGATGCTGAAACTCTGTCC
CCCAGGAAGGAGTTGCGGAACGCCACGTCCTTTCCTGGGGTTGGGGTGGGTGGTGTTTCGACCAAGCATGGCACTGGGGA
GAGTAACGACGGGGCCCTTGAGGCTGAGCTGCAGCATTTGCGTGAGCTGGCCGCCAAGAAAGAGGAAGCTGAAAAGGAGC
TAGCGCACAGATATGCGGAACTGGAAATGCAACATCACCAAACGTTGGACGTGGTGGAGGAACTGAAAACGGAGGTGGCA
AAGGCTCAACAAGCTACCGAAGTCACGTCTCCTCGATCCATCACACCTGTCATCCGCCGCAAGTCCAGCCAGAATGTTTT
GAATGTTGACCGGGCTCACCGGTCGTTTGCGTCTCTACGGAACATCGCTGCCGATAACTTTTCACACAACCCTGATATGA
TGCAAAACTTCGAAATAAATCTCAACGCAGCCATGCATGAGCTACAGGCCAGGGCAGAGCGCATCCAAGAACTAGAGGCT
GGCGTGGCAGCAGCGAAGAGGGAGATGGAAACGAAGATGACAATCATTTCCGGCTTGACCCGTGAACGCTCGAGTTTGAA
GACTTCTCCAATGGACATTTCCCTGACGTCCACTCTACGAGACCAGCTTGAAAAGAACGAGCAGCAGTTGAGAGGATTGC
AGGAAACCTACGGCAAACATGAACGGGAGTTGCAGGCGGAACTCCAGACGCTGCGTGCAGCCATGGCTGGGGATAACTCG
GCTACGGTGCAAGCCCACGTCGACAAGACCCGGGGTCTTGAAAAAGATCTGGCGAACTGGGAGACGAAGCATCAGACAGC
GCTGGAAGCGTTCAACGGCAAAGAGGAGCAGATGAAGAAGCAGGTTGTTGAGCTTGAGGCCCAGCTTTCGCATGTTCAGG
CTCAGCTGGCAGAGGCTACGGCGACTATTGCCTTTGCTGAAGGCGAGGATCCAGCACATGCCGACTCCAAGGTACTGTTA
CTGCAACAGCGCAAGCAGCAAGAGCAGGTCCAGATGCTGCGTACGGAGGTGGACGAGTACAAGGCCATTATCAACAGCAA
TGCGAGCAAGGTGGCCGAGCTTGAAACCAACTACGCGTCTGCAAAGGCGCAGCTGGAGGAGGCTATCAAGGTTCGTGAGG
CGGCGCTCGATGAGGCCTATGTGCACAAGACGCTGGTATCGCAGCTGGAGGAAAGGATTGGCGACCAAGAAAGGGCTCTG
GCTAGCCACGAAGAGAACCTGGAAGCACTTCAGGCCGGCCACGCCGATGACCTTGAGAAAGTGAGAGAAGCGTCGCGGAA
TGAGTACGATGCGGAGATACAGCTTCTCATGACGGAGCATGCAGAGAACATTCGCATTCTGGAGAGCGATCTGACAGAGG
CGCGCGAAGACTTGATGAAAGTGGCGGCCAAGGTCGCGTTTGCTCTCGGACTTGACGTCAGCGTGGAGAAGGTCGCAGAA
CGTGTTGACAGTCTTGTGTCGGTGAAGAAATCGTTCACGGCAGAGCAGGCGAAGACGGCGGAGCTCCAGGAGACTGTGGC
AGAGCTGACGAGTATCAGCGACTCGGTAATGCGCGACCTAGAGGCCGTTCGCTCGGTTTTGACCGTCATGCTCGGTCCCG
ACGCCGAGCTGGTTCGGAAGCCCGGTGCGACTGTGGCGGACCAGATGGCCGTTGTGCAAAAGCGCCTGCACGACCTGGAG
ACGAGGAACAAGAAGAACTCGCGCCTGGTCGACGAGCTAGAGGAGCAGCTGCAGACAAACTTTGATCAGGCCCAGATGAC
AACCAACCGGCTGTCTGTTCTGCAGTCTGAGCGCAACCAAAAAATCGAGGAGGCTAACTCTGCGAAGAGCCGGATCCAGT
CGGAGCTGGAGGCAGTCAAGGAGGAATACGCAGCATTGAAGGTGAGCCACAGACGGGTGCAGACAGTAGAGACACGAGCT
GACCAGACGTCTGCACAGGCTCGCTTTGACGGGATTACGTCAGCCGATGGCGCACCACAGCGGTCCAACTCGACCAACTC
GCAGCTGCGGGCAAGCTCATCGGTGGGATCGCTTCCGTCGCCTCCACCAGCCATCCCGCTGCCACCTCTTCCAGGCTCCA
CCTCGCCACCGTCGACGACTGTGGTGCCATCGACACCGACAACTTCAGGACGGCCACCAAGCAAGGACATTGCGCTCCAG
CAGATCCAGCAGGACCAGGAGGCGCGCATCCGGACGATCGAGAAGCACCTGGAGGCGGAGAAGCAACTGACCCAGACGCT
GGAGGAGGCGCTGACGGACTTGGAGGACCAGTCTAATAAGATGAAGACGGACTGTGAGGCGTGGCGTCGGCGCTGCACAG
ATTTGGAGGCCGAGATTAAGGAGCTCAAGGAGCGTCCGTCACAGGACAACCGGTGGAGCCTGCACCAGGTGGAGGAGGAG
CGCAAGAAGCGGCGCGATGCCGAGATTGCTCGTGCTCATCTGGAGGAGCGGATGAATGCGATCAGCAAGAAGAAGAAGAA
GGGCAGCCTGAACTGCTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62