GenePrediction:GLEAN_2169 Details

Name: GLEAN_2169
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1198100..1203306 (+ strand)
Length: 5207
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1198100..1198489 (+ strand)
Length: 390
Type: CDS
Source: GLEAN
Position: GCSC_108:1198575..1199831 (+ strand)
Length: 1257
Type: CDS
Source: GLEAN
Position: GCSC_108:1199885..1200851 (+ strand)
Length: 967
Type: CDS
Source: GLEAN
Position: GCSC_108:1201511..1203306 (+ strand)
Length: 1796
>GLEAN_2169 class=GenePrediction position=GCSC_108:1198100..1203306 (+ strand)
ATGGCGCCGTCTCTGAATACCCACCCGTCCTTCACGCGGCCACGCACCGGCGACCGTGAAGGCCGTCCCAGCACCCGTGA
CCAGGGCGACACCAACCTCATCATCCCCAGCCGAACGTCATCGCTCCATTCCCGCATCACGCAGCCCATCCCGTCCACCC
TGAACAGCAAGCCTCAGCAGCGGACGCCCAAGACCCTCACCCATGCGTACATGGTGTGCGGTGTCGGCCGTGAGCCGTCC
CAGTGGGTGAAAGCTCCGTCGCCATCTCAAGGGAAGATCGGCCACATGAAGGGTGCTGTCGGCCAATTCTGGCTGCCTGA
AATTCTCGGTAGCAGCCCGCGTCTGGAGCAGGACAACGAGATCGCCCGCTCACTACACGCTGCTATGCGGGTAAGTACCC
AGCTCGTGACTGTTTGGGAGACGGATACGCGTCGGCCAAGAACAGAGTGCTAACGCATGCCATTCGTGACCACAGGCCTG
CTTTCCTCACGACGTCGAGATCTGCACCGGCCGCAGCCAGCCTCACTGTGTGCATCACGCCTTCGTCCTGCAGCAGGACT
CCTCGCACACTCTGTACGGCATCTGCCTGCGGGTCTGGTCGAGGGCTGACGAGAAGCGTGCTGAGACGATCCGCGACCTT
CGCAAGCGCACCGAGTCCGACTTTTACGACAGCGCTGACGAGACATACTGGATTCCTTACTGCCTGTCCTTCCTGTCGCG
CTATCCGCTGTACAACCTCCTGGGCGACTACCTCCGCGGCATGTGGATCCACTGGAACAAGGCCACCAACCTCTTCCACG
CCGAGGAGGTCTCGCGCATCCTGAGCTTCCCGGCGCCGCGGCTCAACGACCTTGTCCGGATCGACATGAAGGACTACGCA
CTCTGCTACCAATTTCCTTCGTCTCCGACCGGCTTCCAAAACTTTGCCATGTGGCCGATGTTCTGCTGCCTGTCGATTCC
CAACATTGTCGGCGTCATCGAGGCGGCCGTGTCTCCGACTCGCCGGATCATCTTTGTCAGCCACTATCCGGCCATGCTCA
CCATGGCGGCCGAGACAGTCCGCTTCTGCGTGCGCGTTTACGAGTGGAGCGGTCTCTATGTGCCGGTCGTCCACGCCCGC
CACGCAAAGGAGCTCGTTGACGAGCCTGGCCCGTACATCCTCGGCATCACTGCCGAGTGCCGTTCGCTGTTCACTGCGCC
TAGCGACGCCCTCGTGGTGGACCTGGACCGCAATTTTGTTCTCACGTCGAGCCCGCCCACTGCTCTGACACCTGGCCAGC
GCAACAAGTTCGTTAGCCGCCTGACAGAGTCCCTCAACGGTGACGTGACGCCGTCGGGTGTTCCTCAGCACCTGCGCTCG
GCCTACGGCGGCGGCAAGCTTGTGCCGGCCGGTCAGATCATCGTTATGCGGGGCGAGGTCGAGTCGATTCAGGACCCAGA
GTGGTGGAACCAGGACGCCATTATGGCTGTGATGGACCACGTGTGCGAGAAGATGGGACGGAACTCTGGCGTCAAGGCCG
TGTTTGGTGGCTCGGTGAAGAAGCCGCTGATGACCAAGGTCTCGATGCGTCACCTGAACGAGATTGTGCGGGAGCGCAAC
CAGTACTCTCGCGATGCTCTGGAGGCATGGCAGGACTTTATCAATCTGAAGGGCCGCATGGACACGGAGCTGGCCAAGGT
GACCAAGCGCAACAACTACCTCGTGGAGGAGCTGGAAAGCTGGAAGCAGCAGGTAAGAAATTCTCACACGCGGATTGCGA
ATTCGGCTGCTAACGATATCCCCAGTTCCTCAAATTCCAGGCCTTTGCCGAGACGCTCACCAAGGAGACGCAAGACCTCA
AGGTCAAGATTGAGAACCACAAGCGGGAGAACCGCCGGCTTGGCGGTCTGATTGACCAGCAGAAGGACGATAATGCCCGT
CTGACGGTGCGGCTCACGGGCACGGAGAAGCAGCGCGACGACGCTCTTGAGGCGTTGGTGCTGCAGCAGGAGATTGCAGA
GGAGCTCGAGCGCGAGCGGCAGCGCAACAGCAAGGAGCTCACGGCTCTTCAGCACACCAATGTGACGCTGGCACGGCAGC
GCGACGAGGCGCGCCGCGTGGTCCTGCACCTGCGCAGCCTCATCGGCGGCCAGACTCACCACATGGAGCACCTGGTCGAG
TCGCTGACCAAGCCGGATGACATTCTCGAGGAGCTCGAGATGTCTTATGAGGATGACCTGGAAGGTACTCCGGAGGAAGT
GCAAGAGCGTCTGCAGACGTTCCGCAGCAAGCGGATGTCGTCGTCCAGCTTCAAGGACGTGGCAGACCGCCACCTCAAGG
ACAAGACGGATGCGATTGCACACATCATCCGCAACATTGCAGAGCAGTGCCAGGCGGCGGTGGAGGGCCTGGAGATGGCA
CAGGACGCGGTGATGTCGGAGGACCGGCGCCGGTCGCTGATGAACAGCCGGCGGAACAGCAACCTTTCGGTAGCAACATC
GGAGGGTTGCGATGACGGCCGGCTGCAGCCGTCGGGCCGGACGTCGAGCATCCCGCCGACGCCGGATCTGATATCGAACC
GGGCGAGCACGTCGATGTCGATCGCATCGACGACAACAACGCCGGAGCGGTCGTCGCAGCAGTACATGATCGGTCACGAC
ATCCCGACCAAGATTGTCGAGGACGAGGACGAGTATGGCAACCGCAGCGACGTGGAGACGATGCACAGTGTTGTCAACAA
GCACTCGGAGAACCTGATCCACCGCTCTTCCGGTGCGCGAATAAGCGCACTCGGGGGTTCGCGATGACTCAAAGATCGGC
GTGGCTGGGGCTGGTGATGCTTGAAGCACAACCAACCCCATTGAATCTAAACAACAACAGAATACACCTTACGGTCGTAT
GCGAACAAACGGTGACGGTCAGACAGCCGACTTCCTGACCTGCCTAAATCCAATCCTCCTTGAACTCCCACCCTGTCTCT
CGCCTTCTCTCTCCCTCCTCTCCCTCTCTTCCTCTCTCTTTCATTTCCTTTCCTTTTTTGTCTTGATTTTGGACGGGTTC
TTATATGACTAAGTGCCGTGGCGTTCTTATATCTGATTCTTGCGGTCTCCCGATATCTTTTTTTTTGTTATCTAGTCTAG
TTTCCTTTTTACTATATTGCCGAGATGATATTTTGGGCGGAAGCAGCCATTTCTTTCCCTATTTTGCTTATTCGCTGATC
AGTGAGGCGGTGGCCTTGAATGCAAAGCTGTACCGTAACGATATAACGCATTGGTTTTATTCGTGATTACTGTCTTGAAT
CTGGATTCCAAAATATTTTGGTTATCTTATCGTATATCTTATCGTGATAAGGCTGCTTTTTAGTCGTGTTTTTTCTTGCA
TCGTAGGACTTCGCTGCATCGTCTTTCTGACCACACACCGGCACCATTGAGTCGACGGACAGATACGCGAACACGTGGCC
ATGTCGGATCCGCTATTGACGACGCTGTGTGGTATCTGCCGGGCAGTACCGCCTCGCTATCGCTGTCCGCGATGCGGAAT
TCGCTACTGCTCGGTTGAGTGCAGCCGTCGCCATCGAGCACGCGCAGGCTGCAGCGGCATTCGGGACGTGACGGCGTACG
TGCCGCGAGCAGACCTGTGCACACCAGCGGGTGTGGACCACGACTACAACTTTCTGCGCGGCATCGAGCTGGCGCGCCAG
CGCAACGAGCGCCACCTGGTCGAGGAGCGTCATCTTTTGCGCAGCGGCGATTTGCGGCCACCGGTTCTCGGCGAGGACGA
TCAGCGTGGCGGCCGGAACACACGAGGTGGCGGCAGTTACCGGGGCTCGTCGAAGCGGCCAGGCGGACAGCAGTCGTCGG
CGGCGGCGGCACCGGCCATGGTTCTGCAGAAGCAATGGCACGGCGACGAGCTACGATTCGTGCCAGTGGTCGACCGTCGA
GGCGCGGCAGCCAAGGTTGTGAACGGAAGCAGCCATGGAGGCCCCAGCAAGAAGGTGCGGACGCTGTGTGATCGCGACGG
GATCGAGCTGCTGGGCGTGCCGATGGGCCTGTCGAGGCAGCGCGAGAACAACACGACGGTGGCGACGCTGATGGCGTCGG
GAGCGGGAAAGAGAGGACAGACAGCCGCCAAGGCGGAGGGCCAAGTACACCTGCACTGGCAGGTCGAGTGGCTCGTGTAC
GAGGACGGCCTGACGGCCAAGCCGACCCGCGTTTTGCGGCGGCTGCTGGATCACGTGCCACTGTGCCGAGGATACGCGGC
CATGATGGCCTGGGTGCTGCAGCAGACGGGTGGCATTGTGGACGATGATGTGGGCGACAGCCGGCGGAACCAGGGCCACA
CGAACGAAGACGGCGGCCCGAAGCTGCAGGCCAAGAAGCGACGAATCCACCTGCTGTCGCAGCCGAGCAAGAACAAGAAG
CGGCGCACGGCAGGAGGTTTGGCTGCGCGTCCGGATCAGGGCCTCGGCGACTTTGCGGCGACCTATGCCTGGCAGGACCC
AAAGACGGGCGCATGGGACGGCAGGACCGACGAGGACGAGAGCCCAGACGAGGACGAGGATGGGGACGAACAAGACGACC
AAGTCGAAGATGAAGCTGTCACTGCGGCGCGGCGCGATATGCTGTTCTTTTTGCTGCGTCCACGCCTGCCGACAGCCAAG
GAAGCCGGGGCCGAGAACAAGACCACTGCGCCTCCGCCACCAGCCGGCAAGGAGCTCATCCCTCTGCTGCCCGGCGACAC
GCTGGCAACGGCTCTGCCAGGCCGCGCCGTGCTCGAGTTCCCGACCATCTGTGTGTTGCGGCGCGGCGACGCCGACATGA
CGGGCGGGCTGGTTTTGCCTCCGGGTCACGTGCTCGGCTCGACGGCTCGAAAGGTGGTCCACGCCGGCACACCGATGCTA
GGCGGATTGTCGGCGTCAGTAGCGGTACAAGCAACTGAGGATAGCGACACGAGCAGCTCGGGGACGACAAGTAGTGAGGA
GAGTGGCGAGGACGACGACGATGCGAGTGACAAAGAGGACGAAGATGGCGCCGACAGCAAAATGGCAGACGCCGCAGACA
TCGACCCGGACCTGGACTCGGATGCGGAAGACGGCTTGCCGCTGCTGCGCGGTCTCAATGGTGGCTCTAAGTCACGACTG
GTCGTGTACGACTCCTGGTCGGAAGCCTCCGGAGACGAGGGCAGCAACAAAAGGCCCAAGGCTGGGAAGAAGGACAAGAA
TGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62