GenePrediction:GLEAN_216 Details

Name: GLEAN_216
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:319677..321804 (+ strand)
Length: 2128
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:319677..320199 (+ strand)
Length: 523
Type: CDS
Source: GLEAN
Position: GCSC_167:320249..320973 (+ strand)
Length: 725
Type: CDS
Source: GLEAN
Position: GCSC_167:321097..321804 (+ strand)
Length: 708
>GLEAN_216 class=GenePrediction position=GCSC_167:319677..321804 (+ strand)
ATGAATTGTCCCTCTCGGACGGACGAGCCGGCTCGCAGCGACGGCCACAACCAGAACCCCAACGCGCTATCCAATGACCT
GACGACCAACCAGGACCTCAACGGCATGGCCAACGCCCGGCGTCTGCGCCGCACCGCCTCGCTTCCGCTCCAGAGTGCCG
GCCTAGCCGACGATGCTGCTGCTGCGACCGGGGTCATGATGGAAAGCACAGACGAAGGCGCGGGCCCGTCGGCCGGCGTC
GTGGCCGGTGACCGGATGTCCGTGGCTGAGGCCCCGGCTCCGGCCCCGGTGTCTCCGCAGCTCGGCTCCTCTACCGAAAA
GGAGCCAGCGCGGAGCCGAGTCCAGGCAGAGGGCCTGGACGGAGGGGGACGGGGAGAGGATAGAGAGGGGGTAGAACGAC
AGGACCTGACTCCGAACAACATCAAGCACCGGGGCATTTCCGGCTTTTTTCGTCGCGTCGGCAAGACTCTGGTGACGTTC
TACCGTTTCGTTGGGCCGGGCTTCATCGTCGCCGTGGCGTACAGTAAGATTCTGCTTCACATCCACGTCCACATCCATCT
GCTGACCTCCAGTCGATCCGGGCAACTATTCGACCGACATTGCGGCCGGTGCGTCGTACCGCTTCCGGCTGCTCTTCATC
GTCCTGCTGAGCAACCTGTTTGCCATCTTTCTGCAGAGTCTGGCCATCAAGCTCGGCACTGTGACGGGTCGCAACCTGGC
CGAGGCCTGCCGCGCCTTTCTGCCGTGCTGGCTCAACGTGACCTTGTACGTGCTGGCCGAGATCGCCATCATCGCCACCG
ACATTGCCGAGGTCATCGGCACGGCCATCGCCCTGAACCTGCTGCAGCCCAAGATCCCGCTGGTCGCCGGTTGCGCCATC
TCCATCGTTGACGTCTTTGTCGTTCTCTTCTTCTGCCGGCCGGCTGACGAGGGCGAGCAGTCGAAAAAGGGGACGGCCAA
CCAACAACCACGCCAACACGTTCGCCGCGGCATGCGCGCCTTTGAGCTGCTCGTCGCCGCCCTCGTGCTCGCCGTCGTCG
TCTGCTTCTGCATCCAGCTCTCGCTCGTGCACCGCTCGACCACCGGCACCACTGCCGCCAAAGTTTTGCGCGGTTATCTG
CCTTCGTCTGCCCTGGTCCAGCCCAAGGCCATCTACCAGGCTTGCGGCATCCTCGGTGCCACCGTCATGCCTCACAGCAT
CTATCTTGGCTCCGGTATTGTCCAGGCCCGCCTGCGTGTCTTTGACGCCCAGCACGGCCTTCTCCCGGATATGCCTGGCA
CCCGGGATGTTGACGATGTTGACTCGGACTCGGACGACAACAACAACAACAACAACAACAACAACAACAACACCCCATCT
TTTGCATATGTCCCCTCGCTCCGGGCCATCCGCCACTCGATGAAATACTCCATCGCCGAGTTGGCCCTTTCACTCTTCAC
CTTTGCCCTCTTTGTCAACTCAGCCATCCTCGTGGTCGCTGGCGCATCGCTTTACGGCAATGCTGCTGCCCAGGATGCCG
ACATTTTTGCCATACACGACTTGCTGGCCCACAGCATCGCCCCGGCTGCAGGAACCGTCTTTGCGCTCGCTCTGCTCTTC
TCCGGCCTCTCGGCCGGCGTCGTCTGCACCGTCGCCGGACAGATGGTCAGCGAGGGCGCTCTCCGCTGGACCGTTGCTCC
TTGGCTGCGCCGTCTGCTTACCCGCTCCATCAGCATCATGCCCAGCATCGTCATCGCCGGTGCTGTCGGCCGCAACGGTC
TTGACACCGCCCTCAACGCCACCCAGGTCGCCCTCAGCATCATCCTGCCCTTTGTCACCGCCCCGCTGCTCTGGTTTACC
TGCTCAAACCGGTACATGACCGTCCAGCCCGGTCGTGCTCGCTTCCTCCTGGACGAGAGTCGTCGTCGTCAAAAATTGAG
GGCTGCAGCTGCTGCGACTGCAACTGCGGCCTCCGGCATTGTCGAGAATACCGGCACTGCTGCTGTCGCCCAGCTCGAGC
CGGGCGACGGCGTCGAGCAGCCCGTCAAGATGGCCAATTCTTGGCCCGTCGCCCTGCTAGGCTTGGCCATTTGGCTGATC
ATGGCTGCCATGAACGTGGCCAATCTGGTCCTCCTGAGGTCCGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62