GenePrediction:GLEAN_2170 Details

Name: GLEAN_2170
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1206866..1209299 (+ strand)
Length: 2434
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1206866..1207558 (+ strand)
Length: 693
Type: CDS
Source: GLEAN
Position: GCSC_108:1207598..1207973 (+ strand)
Length: 376
Type: CDS
Source: GLEAN
Position: GCSC_108:1208041..1209299 (+ strand)
Length: 1259
>GLEAN_2170 class=GenePrediction position=GCSC_108:1206866..1209299 (+ strand)
ATGTCCAGCCGACAGCTGAAGAAACTGCGGGCGCAAGAAGAGCAGAAAAGGGCTGCCCTGGCCGTCGACGGCGACGCCGA
CGAAGCTTCTTCGGGAAGCGAAGAAGAGAACCTAGGCGTTCGGCCGCGGGCCAAGAATGCGTTTGCTGCTTTTGCGGCGC
TGGGTGGGGATGACGACGGGGATGACGGGGGCGACAACAACAACGACGACGACGACGACGACGACGACGACAACAGGCAC
AACGAGGATGGCATAGAACGACCACCGAGTTCACAGCAGCAAGCGGCCAAGACGGCGAAGCCGGGCAAGAAGAAGAAGAA
GGCAAAGAAGAAGGACAAGGGAGGCAAGACGGAAGCGGGTGCAGAGAGCGTGTCGGTGGCGAGTTCGCTGCCGGTAACGT
CGCCGGGGAAGAAGGGGGCTAAGACAGAGAGGAAAGCAAAAAGCGCCAAGGACGCGGCCGCCGAGGACGACGGGCTGGAC
GAGATCGACCGGGCCCTGAAGGAGCTCAATATACAGAGACCAGCGGCACAGCAGCAGGTCCAGCGGCAACAGGACCAGGA
CCAGTCGGCCACGGTGCTGGCGGGGGGCGGCAGCAACATCCGGATCCGGCTGAACTTCCACGATTTGCGCGTGCTCAATG
AGCTGCGAGACGTTTTTGGGCGCGACACGATCCGGGCGGCGCGGGCGGACGAGGTCAACAACAGCGGCGGGCCGGCCGGG
GGGGCACAGCAGGGCGAGCGCGTCGACGGCAACCCAGGCGTCGTCATGGTCGACCTGGAGACGTTTCTGCACGGCACGCC
GACCGTGGCGCCGGGCATGGGTCGACGAGCCGGCGCCATGCTCGCGGCCGCAGCAGCCAGCCAGCGCGGCATGACCGAGG
CGGTCGCGCGGCGCAATCCGTTCATCGAGTTCAAGGACACCTGGGCGCGGGCGCCGTCGGGTGGCCTGGGCATGCGGCAG
GTGACGCCGACAGCTGCTGCCACGTCCAGTGCTGTGGCCGAGTACACGTTTACGCACAGCCCGGCCTACGTCCAGCTGGA
CCAGACGTTCTTCTCGCTGGTCATGATGCACAACCACCATCCGCTGATCCAATTTCTGAAACAGAACCGTGAGTGTGCGA
CGGCCAACACAGGTGCAATAAGCTGAGCAGTTGATGAATCCCGCTAACTTTTCAGCCTACCACATCGCCTCACTCATCCA
GGTCAGCCGGGTGGCCAAACAAGACCAAAACGCGGCCCTGGCAGCCGACCTCTGCGAGCGGGCGCTCTTCTCGTTTGGCC
GCGCCACGCTGTCGTCGTTCCGCCAGAAGCTGGCCGAGGGCCTGGCGCGGCTCAGTTTCCGCCGACCCGAGAACCGGCAG
TTCTTGCTGGCGGGCTACTACTACATCAAGAGTCTGATTCCGCGCGGCACTCATCGCACCGCCCTGGCCTGGGTCAAGCT
GTTTCTCAGCGTCATGCCGGACGACGAGTACGGGCTGCTGCTGTGGGGACATGCGCTGGCTATCCGGGCGTCTGAGGAGC
GCTGGCTGCTCGAGGTGTTTGGTGCGACTGACAAGGCGGGCGATAAAGTGGATGACAAAGCAGATGACAAAGCAGATGCC
AAATCTATACCGGCCGTCCGCCGCAACCCCATGCGGGCCTACATCCGGCAGACGCTCGTGGTGGCGCGGCTGCAGCTGGG
TGACGAGGCGGGCGCACGAACGGCACTGGAAGATGGGCTGACACGGTTGCCGTGGCTGTATGGCGCGCTCTTCCAGGCGC
TGGGTCTGGATGTGCCGCTGGCCGTCTGGGGCGTGCAACCGCGCGACGACGCCGAGGCCTTGTATACGCAGCTGTATGTG
CAGCAGGCCCGTGACTTGTGGGAGTCAACGCCGGTGGCGGCGCTGCTTCGGGATGTGGCAGCGACGATGCCCAAGCAGAC
ACCGGCCGCCATCACTGTCCTGCCGCCGGCTGAGCCCGTCTCGCCCAGCATTGCCCGGTTCGCCTACCTCGACGGCACGC
CGGTCACGATGGCCCTGGTGCCCGGCAGCATGCTGCATGCGTCGCCCAACTACGACTTTGACCCGCTGCCGCCGCCACGG
GCGCTCAACATCTTCTCGCACGTCGGCCAGGAGCGGCCGTGGATCGTGGCGGCCAACGAGGAGGAAGAGGAGGGACGTGC
CGGTGCCAGTGCTGGTGCTGGTGCTGGTGCTGGTGCTGGTTTTGATGCCTGGGGTGCCCTCGACCGCTTCCTTATGGCGC
CCGGGGCCGCGCTGGACCCTGGTTTTGGCGACGAGGACGACTTTGACAGCGGAGGTGACGACAACGAGGACGAGGACGAC
GAGACAAACCAGCACGCAGACGTCCAGACAAGCCAGGAGCAGTATACCCGGCAGAGGACGGGCAGCATGCCGGGCGCGTG
GGTGGAAGACGTCGACGATGAAGAGTTTTTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62