GenePrediction:GLEAN_2171 Details

Name: GLEAN_2171
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1210110..1210448 (+ strand)
Length: 339
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1210110..1210197 (+ strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_108:1210279..1210448 (+ strand)
Length: 170
>GLEAN_2171 class=GenePrediction position=GCSC_108:1210110..1210448 (+ strand)
ATGGCCGACCACACCTACACCTTTAATGTGTCCATGTCCTGCGGCGGCTGCTCTGGCGCCGTTGACCGCGTGCTCAAGCG
CCTAGAAGGTAAGATATTTCCTGTGCCCCTCTCACCTTTCCCCGCCTTTCTTCGACCCCCTTCGCATTGCTGACAGCTGT
CACTTTCAGGCGTCAAGAGCTACGAGGTCTCTCTCGAGAAGCAGTCGGCCACCGTCGTCGCAAACCCTGAGCTTTCATAC
GAGACCGTTCTGAGCACGATCGCCAAGACTGGCAAGAAGGTCAACTCCGGCGAGGCTGACGGCGAGACCCGCAGCGTGGA
AGTGCCAGTCCAGGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62