GenePrediction:GLEAN_2172 Details

Name: GLEAN_2172
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1211104..1212854 (+ strand)
Length: 1751
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1211104..1211430 (+ strand)
Length: 327
Type: CDS
Source: GLEAN
Position: GCSC_108:1211632..1211886 (+ strand)
Length: 255
Type: CDS
Source: GLEAN
Position: GCSC_108:1212535..1212597 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_108:1212759..1212854 (+ strand)
Length: 96
>GLEAN_2172 class=GenePrediction position=GCSC_108:1211104..1212854 (+ strand)
ATGGTTGCCCGTCATCGGCTGCTGCCTGCGGCCTGGCCAGAGTTGCCAAAGTTGTTCTTCCACGACCGGCCTCTTTGTTG
TACCGCGCTGTTTGTCGTCCCGCTTACGTGCGATCCTCCACATCCACCCAAGCGGCTACGCCTCGCCGGACACCTGCCAC
CTGCACCTGCGACACACGTATCTTATGATTTTGGCCCGTATCCGCTCCGTAGGCGCCGCTCCTGGCGCCAGCTGCTCGCC
TACCTGCCAGGCCGCCGCCGCCATGTCGGCCACCGCCTTCTGGACCCTGCGTGCTTCTCGGCCTTCTTCCTCAACTTCAC
CTACGACGTATGCGACGCCAGGGGGGAATCCCCCTGCTCTCCCCTTCCCCTAGACCCCTCTTTTTCCATCTTTCTGCCGT
CTGTCTTCCCTGCCGTCTTCGGTGTGCCTTTTTACTCTTTCTCTTCTTCCATTTTTTTTTCTTTTATTTTGCGTATTTCT
TTTCTCTCCCACAAGCGAGCGCATACGACTCCGTATGCGGCGGCGCAGCCCAAGCCCGGCGCTATCAGAGCCACCCATCA
TAGTAGCATTAGGGCATCCGTTACACCGGCAACGCCGGTAGTGTCGGGAGTGTCGGTTACGCTGGCGACTCCTTCGTATC
TCAAGCTGCCGGCAGTCGGCCGCGGCAGCGGCAGCGGTGTGAGATGGCCACCACGCGATCCCCATGTCCGCAGCAGGTCG
ACTATGCATGCGACCATGGCGACAGCGACCGTGGTGAGCAAGAAGGGCGGCGAGCAGTGTCCCGTACGAGGCAAAGCAGT
CGGGTCGGGTCCAATTTCCTATCTTACTTTGCGGAGCCAATCCACCCCAACCCCCCTTTTCCCCACATCTTTTTTCTTCT
CGTAGCTTACAGAGTACGGAGTACCCGTACTCGTACGTGGTCTTGATTGTGATAGACTGTCATTGTTCATGGTCGGGTAG
TCCCATAAACACATGCATGTCTGTCGACTTGCTGATTGTGGTCTCGTATTGCCAGGTGTATTAAATCTACTCTGTACACC
GTAGACTCTCCTTCAATCTTGCTCATAGTCAAGGCGTTTCCATGCAAGGCATCTTGCATGCGAAGCACTCGTATAATGCG
GTACGTCCCAGGGAGCACAACCCGTGGAAATATCCGCGCGTGCCCGGGTATAAGTGCAGACGTCTGGTCGTAAGACGCCG
GCATGTTGTTCTGTCGGGGCCAAGAGCTATAGCACGTGTCTGGCCGAAACGAAGGACGCCTACGCCGGCACTACCTACCA
CTAGCCGGGGTGTGCAATAAAACAAGTATCCTATCTTGCCCAAATAGCCCGGATGGGGGCCTGTCCTTCTAGAAGAAGTC
GGCAAAGGCAAGTGGCCCTCGGAAAATGCGCGCACAGGTACATAAATGTAAAATGCAAACTGTGGTTGCAGATAGACCGC
TGGGACCTGCTTTCCGGCTTCACAGTCAGAGTGGCTCAAGCCAAGGACTTGCTCGTACGAACCGTCCTCGCAATTTCCCT
TACCACACAAAGTAGTTCGGAACGCTCCTTACTGCTTCAGGACGTACGTCGTAAGCGGCATGGCAAGGCCCACCGGCGAC
TAGCCTGGCGGCAGCGCAGTGCCGGGCTCCTCTTTTCCCATTGACCTGTCTGCAGGCCAATGGTGCCGGATCCGAGTGGG
CTGTCCGGAGGAAGCAGAGCGAGAGCGAGAGAGAGGGAGCCACGTCCCAGCCCCTTATGCATACATTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62