GenePrediction:GLEAN_2173 Details

Name: GLEAN_2173
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1215084..1218312 (+ strand)
Length: 3229
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1215084..1216016 (+ strand)
Length: 933
Type: CDS
Source: GLEAN
Position: GCSC_108:1216151..1218016 (+ strand)
Length: 1866
Type: CDS
Source: GLEAN
Position: GCSC_108:1218080..1218160 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_108:1218223..1218312 (+ strand)
Length: 90
>GLEAN_2173 class=GenePrediction position=GCSC_108:1215084..1218312 (+ strand)
ATGCAAGAGCCCAGGGTCCCGGGCCGCGAGGTCCCTGCCGGCACCTCCCCTACACCCGCGATGACCTCCCGCAACCTGGT
TTTTGATGTGACCAACTGGCACCCGAAGCCCGTCAAGCGCCCTCGGCCTGTCAAGTCCTGCACGGAATGTCGTCGTCGCA
AGCTGCGATGCGACCGGCGCTGCCCCTGCTCGCAGTGCCAGCGGTCCTACCGCATTTGCAAGTACGGCAGTGGTGATGGA
AGCAACAGTCGCGGCATCGATGCCAACGGCTCCCTCATCGACTCGGACGGCTCCGAGGGCGGCTACGAAGACGACGACTC
CATGAGTGGCGGCGGCGCTGGCGAACGTCCGCTGAAGCGCCACTCCAGCCGACCGATTTCCGGCACGACGCCCCAACCTG
TGGCTGTCGGCATCTCTCAACCGCCACAGCCGTTCAATTCGTCTCTCAGCCTTCTCCTGAACCCGCCATCTCCGTCTTCA
TCCCCGTCCACGCTCCGCGCCCCGAGCCTGGTCTCTTCTTCCGCGCCTGCCTACGCATCCTCGGCGCCGCCCTTTCCTAC
TCCTTCTTACGCCTCTGTTCCGGTGCCTATGCGCATAGCTGCGGTGTCTACAGCCGTCCAGTCCCCGCTGCTGACCCTGA
ACGGCCACGAGCTCCGGCAGTTCACTTCCGACCTGATTGACGAGTTCTCCACACGCATGGAGCGCCTCGAAAAGCTGGTG
CTTGCCAAAGACTCTTCGGCCCTGTCGTCCATTCCGCCCTTTCCCTCTTCTTCTACGCTTTCGCAGTTACACCTCCATCA
ACAGCCCGATCAATCCGGTCCGCATATTATCGACCCTTCGTCGCCAACCATGCGTTGCTTGACTGTCAACGAACCCGGAG
GCTTAGAATCGCGGGTTTTCGGTCAAAACAGCACGCGTGCCCTGCTGAACTTGGTTAGTGTCTCGCTCCTCCCAATGCAT
TTCGGCTTTGTCGTCCCCAGAAGGACACACGAGCAGTTTTGAGGACCAATTACGCCTCAGTATAGGGACTTGTGCATAGC
TAACCACGCTGTTTTCATACCTACCAGTTCGACGAGGCCAAAGATTTCATTTCCGATCAATCGAAACGAGATGTTGCCGG
GGACCTGTTCTCGAGCTTGGAACGAGCATACAACGCGCTCCGGGACGAGCACCAGCAGGTCCTCAGGCCCATTACCGTCT
TTGTCGATTCTATGATGCCAGTGCAAAAGCGCATGGCTGATATACTGCCACGCCGCGATGTGTGTGACCGCCTGCTTGAC
GCCTATATCAGCATGACCGAAGGCCTGTACCGTGTGATTCACATCCCTTCGTTTCGCCGGGAATACGAGGCCTACTGGGA
TAATGGAGGTGCTAGCGGCATCAGCAACATTGCAAGCGTCCCTACCTGCGCCAACGGCCCCGGCGGCATCAGCACAACAC
ACCGTGCTTGTGCTGAGGTCTTCCTTCCGCGACTACTCTGCATCATGTGCATAGGATCGCGCTTTGAGACTGATTCCAAG
GGTCTCTGCTACGACAGATCCGACGGCGTGCACATTCCAACAGCCTGCTCTCTGGTGCGGTCTTGGCTCGAGACCGCTCG
CAGGCGGCAATCGACAGACCTACACACCTTGCAGGCGGAACTGCTGCTGCAGCACGCCAGTCGCATGATCGATCCACACA
TGCTGAGGACGTGGAACGAGCTGGGACTGATTTCTCGTACAGCCATGGCGATGGGGCTGCACCGAGACCCATCTGAATTT
CCGATGCAAATGTCGCCCTTCCACGCCGAGTTCCGCCGCAAGCTATGGCACACGATCATGGACATGGACCTGCACGTTGC
CTTGGCCAGCAGTCTCCCCACGGCCATGCGCGAGGGCGAGTTCACGTGCAAGCCCCCGCGGAACCTGGACGATGTCGACC
TGTACCCGGAGATGACTACTTTGCCGCAAGCAAAACCGATGGATCAGTACACGGACGGACAAATGCAGGCTTATGCAGCC
TGCACATTGCCGCTACGCATGCGTGCCAACGACATTCTTTGCCGCATCGACTCGGTGCGGGACTACGGAAAAGTGCTTGC
AGTCGGTGGCGAGCTTGAAAAAGCGCTGGATGACATCAACTGTCTCTTCCCGCGCAACGCGGCGCTGGGGACGGGTAACA
AGTACAAAGCCTGGCGGATGCGCGCGCTCTTGGACATGCACGTGCGGCGGCCGCTTGTAGCGTTGTACCGCCCTTTCGCG
CTGAGTGCATCTCCGAACTATCCGCCGCCCACAGCCATCACGGATGTGTACCTCAAGTCATCTATGGCGTTGCTGACCTA
CATGGAAGAGCTGGACCCAAACATTCCAGGCTTTGACGATGTTAGCCATATGTACCATGTGATTTTACGGCACGACATTG
TTCAGGCTGCTTTCAGTGTCTGTTTCTATATCAGACAGGCCTTGGAAGCAGAGGAATCCAACAACACAACGCCGTCTTCC
GGGGGCAGTACTATCGTCTTCGGTGGCACGGATGGAGGGCAGGGAGTGGCAGCTCGAGGCGGCAGGAAACTGACCCCAGA
CGACGTCAAGGTCTCCGGCCATATTGGTAGTCATACCCCTACCTCGGCCCCCTTCGCCCCGATGGCAGCAGTGTCCGACG
GTGGAAACAGCAGCACGCCGGCCGGAAACAACGGTGGCAACAAGAAGCGGGTGCACTCGCTGATATGGTCTGCGACATAC
ATGATTCGGACGGTGGAGCGGACGACGGAAAATCTTGCTCGGCTGGCGGGTGATCTAAGCAATGACCTGCGGGACGTTGT
TGCCCTGGCGGTTGTGCTGGGATCCGTGAAGCCGGCAGCGAACCAGATACAGCGCAACGAAAACATACGAGCACAAGTGG
GGCGTGTGCGGGATGCTTGCTTTGATACGCTACGAAGGCATGCGTCTCCTGCAGTATGTGCTCTTTCTCTACCCGTGCTT
GACACATTCGTACCGTTTTTCGCTGACCACAGATAGATTCGCGCATTGGTGTCTGCGCCGGACGTGCCACTTTCACATGT
TCCTGATTGGTACAACCGGCCAACGTTGCAGAACGAGGTAAGGACGACAGCTCACCCAGGCATTGCTGACCAAGACATAC
TAACATGCCGTTAAAGCAGCTCGCCCAGCCCACCGACGAGTCCGCGTTATTGGACATGGGATTTTGGGATGTATGGGATA
TGCGGATTGAGGCAGGGGCGAAGCATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62