GenePrediction:GLEAN_2178 Details

Name: GLEAN_2178
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1229316..1230512 (+ strand)
Length: 1197
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1229316..1229499 (+ strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_108:1229578..1230161 (+ strand)
Length: 584
Type: CDS
Source: GLEAN
Position: GCSC_108:1230228..1230512 (+ strand)
Length: 285
>GLEAN_2178 class=GenePrediction position=GCSC_108:1229316..1230512 (+ strand)
ATGAGTGCAGAAGCAAGTGGCAGTATGGACAACAGCAGTTCCAAGCCGATGGTGGATAACAATGTCGGATTTCGCCCACA
GATCAACATGGAGGTCACCCCTCCTCGCCCCGAAGACCTGCAGAAGAGCTATGCGACCATCGTGAGCGACTACGCTGGCA
CTAACGACTGGTATGGTGGAATGAGTACGTCCAAGCCGTTGCTATCTATTTTCCATGCTACTGCTTCTTTGGCCGGCTGC
TAACGCTTTCTTCTCACCGCAGTCAATACGCTCGGCACCTGCATCGGCGGCTTGGGCGCTATCCCCTGCTGCATCTGCTG
TCCGAACCCGTATAAGAGCGTCAGCCAGGGCAACGTCGGCCTCGTCACCAAGTTTGGTCGTTTTTACAAGGCCGTCGACC
CGGGCCTGGTCAAGATCAACCCACTTAGCGAGCACCTGGTCCAGGTAGACGTCAAGATCCAGACGGTCGAGGTGCCTAAG
CAGGTCTGCATGACCAAGGACAACGTCACCGTGCACCTGACCTCGGTCATCTACTACCACATTGTCAGCCCCCACAAGGC
CGCCTTTGGCATCAACAACGTGCGCCAGGCCCTCATCGAGCGCACGCAGACGACGCTGCGCCACGTTGTCGGCGCCCGCA
TCGTACAGGACGTCATTGAGCGGCGCGAGGAGATTGCGCAGTCCATCGGAGAGATCATCGAGGACGTGGCCGCTGGCTGG
GGTGTCCAGGTCGAGAGCATGCTCATAAAGGACATCATCTTCAGCCAGGAGCTGCAGGAGTCGCTCTCCATGGCTGCCCA
GAGCAAGCGTATCGGAGAATCCAAGATTATTGCCGCCAAAGCCGAGGTACAATTTCTCTTCTCTCTTTCTTGTCTCCCCC
CTACTACTCTGTTCGCCTGCTAACCTCCTTAGGTCGAGTCCGCCAAATTGATGCGCCAGGCTGCCGATATCCTGTCGTCG
GCTCCCGCCATGCAGATCCGCTACCTCGAGGCCATGCAGGCTATGGCTAAGACCGCCAATAGCAAGGTCATCTTCCTGCC
AGCCGCGAACCAGACGATGCCCGGGTCATCGGCCTTTGATACGGCCATCAAGCAGGCGAACAGCGAGCCCGGAGAGCCGA
GCAGCTTCCAAGAGTTTGGAGGTCAGGACCACAGTTTCCAACAGGCTATCAACGCTCGGGTGGTCGAGAGCATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62