GenePrediction:GLEAN_217 Details

Name: GLEAN_217
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:322482..326939 (+ strand)
Length: 4458
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:322482..322563 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_167:322820..322877 (+ strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_167:323717..325047 (+ strand)
Length: 1331
Type: CDS
Source: GLEAN
Position: GCSC_167:325120..326939 (+ strand)
Length: 1820
>GLEAN_217 class=GenePrediction position=GCSC_167:322482..326939 (+ strand)
ATGTCGCTGCCGGCAAAGCTGCACATCTGTGCCGCGCCCCAGAGTGTCGGTGAGAAGTGGAAGCTGATTGGCCGCCAATT
TGGTATACCGCTGTTACCCTCCGTTTGTGGCCGTGGGCCGCTCCGAGACAGATTCAAACAGACCTGTTCGCGGCCGGCTT
GCTGCTTCTGCTGCTGCTGCTGCTGCTGCTGCCTGCTGGACAAACAGTTCGCGGTCATATGGCACGGCAGTCTGGCCAAA
TCCGCTTCATGGCCCCACGGATCGAGCTTGCCGTCTTGCCATTGGGCTTCCCCAAACACCCCCCCACCCCCCCCCCCCCC
CCACACACGTCCTCATAGCCCATGACGAGATGGGTGTTATGATGACTCCAAGCTCGTACAGCATGGTCGTAATCATGTAT
GCCGCTCGATGTTCTCCCTCGTTTGGTGAACACTGACGAGCGGGACTCGTTCCTAGGCTGCAACGGGGCTAGTTTTGAGC
CGGGTAGTGAGCTAGTACTCCGTATTGGGCCGGTGATGTTGTCCTTTCCTCTAGCATTGACCCCGACTACAAAGCTTGCC
CGTGGCCGCCTCCTCTCTCTGTCCGTTCCCCAGACGCTTCTCCATGCGAGGAACTCGAGAAGCCCACATTTTGCATACCC
ACTTTAAAACAGCTCTGGGGCGCTACCGGTCGTCAGTCGGGCAGCGACTTTCTCCTCTCTTTATCAAACACAACCGATCC
TCTCGGCGGTGACGACATCAAAAGCTCTCCCGTCTCTCCAAAACAGCACACCCGGCAGGAAGAAGGTGCAACGACTTACC
GACATGGCGGATAACCCAGGAAGAGGTCGAGGACGCGGTGGCGGTAACCGCGGTGATCGTGGAGGCAGAGGTGGCGGTGA
CCGTGGAGGGGGTGGTGGCTATCGGGGTGACCGGGGCGGCGGTGGCTTCCGTGGCGATCGGGGTGGTGGTGGTGGATACC
GTGGTGATCGTGGTGGCGGTGGTGGCGGTGACCGAGGCGGTGGCGGGTACCGTGGTGATCGTGGTGGCGGAGGCTACCGT
GGTGATCGGGGAGGTGGTGGTGGTGGCTATCGTGGAGACCGTGGCGGCGGAGGCTACCGCGGCGATCGTGGAGGTGGTGG
CCGTGGTGGCCGTGGCGGCTATGCTCCGTCCGACTACAGCGCGTTCAGGCAAGCAGAACTTCGTGTGCTGTTGTGCCGTC
CCGTTCGATGATCGATGTTCGCTAACCTTGCACAGCTATCCTGACGGAGTGGTCCAGCCGAGTGCGGAGATTCGTGCTCT
CGAAAACAAGTTGATGGCGGCAGCACCGGCTGCGACGGTGAATGTGACCGCTGTAGCCCAGCAGCTGCAGCAGGTCAGCG
TCTCCGGACCGGCCGCCAAGGGTAAGGGTAAGGGTAAGGGAAAGGGCAAGGCTTCAGCTCCGGCTCCGGCCCTGGCCTCG
GTGCCACCCTCATCCGGTGGCGGGAATGAGGACCTTGCTCGGTTCCCTCGACGGCCAGCATACGGAACGACTGGTGCTTC
GGTTGTTGTCTGGGCCAACTTTTTCGAGCTGAGCTTCGGTCGACTGCCACAGCTGATGCAGTATAACGCACAGGTCACAA
AGATTGGCCGTATCGTCCGCCAGGATGCAGGCAGCAAGGGCAAAGAGATCCTTAAGCTGCCATACACGTCGATGCTCGGG
CCCGATGCACCGGCCGATACGTCGACGGCGCCCGAGGTCAAGGGCCCGCTGCTGCGCAAGGTGTTGCGCTACGTGCTGAC
GGAACGGCTGATCAACATCCCGGCGGCGAGCGAGCTGAAGAGCAAGATCATCACGCTGGCCCCGCTACCCGGATGGTTGG
GCAATCCGCCGGTGCTGGATGACGTTGAGTTCGAAGGCAGTGTGTTCCGCGTGCAGTTCGACGGCCCGGTGGTGCTGCCG
CTGGACGGCCTTCAACACTGGCTGCGCACGATGCGAGACGAGCGCGACATCAATGACAGTTTCTTCCCCAAGTTCCCCGA
TGTGGTGGACGCAGTCGGCATCCTGCTGGGCCACGCGCCGCGTATGGCCACGCCCGGGACGACGACCGTGGGCAGCAGCC
GGTTCTTCACGACCGACATGCCGGCAGAACGGACTTCGCTGGGCAACGGCTTTCTCGAGACCGTGCGTGGATATTTTCAG
AGCGTCCGGCCGGCCACCGGACGGCTTCTGCTCAACGTCAACGTGACCCACGGCATCTTCCGTGAGGCCGGTCGGCTGCC
CGACATCCTGCGACGTGCCGGCCGACCGACGGTGCGGCTGCACAACATGTTGAAGAACATGCGCGTAGGCGTCGATATTC
CGGGTGTCGGCCGCCAGGACTACTCCATGGGCGGCCTTGCCCGACGAAGCGACAATATGCGCGGCCGAGGACGACGGAAC
AGCGGTGGTAGCGGCCACAGCGGCAGCAGTGTCGACGACGTTCTGCACGTGCGCCAGGACTTTGCCCGGCCGCGTGAAGT
CGAATTTCGGTACAGCGCAGGGTCAAATCCGATTGCAGGGCTGAAGGACAACTCGATGGTGACGGTGTATGATTATTTCC
AAAAGAGTAAGTTTCCTGAGTGGTTGCGGTCTTCCGACTTTTCGTATTCTTCTGTCTCTCTATCCTCTAACTCTCCAGAA
TATCACGTCCAGCTGATGGACATTCCTGTTATCAACCTCGGCAAGCGCGACAACCCGCGCTACTATCCGGCCGAGTGGTG
CACCCTGCTGCCCGGACAGCCGGTCAAGGCACGGTTGAGCGCGAGCGAGTCGGCGGCCATGATCCTTTTTGCCTGCCGCA
CGCCGGTCGAGAACGCGCGGTCCATCACCGGGCTGGCCCGCCAGGTACTGCAGCTGGACGGTGGTGGCAGTGGTGGCAGC
GAGCTCTTCCGCCAGTTCGGCCTGACTGTGGCGAACCGCATGGTGGCCGTGGACGCTCGTGTGCTGGACTCTCCACGCAT
CCAGTACGCCAAGAAGGACCCGGTGCGCGTGGCCAAGGGTTCCTGGAACCTCAACGGCCAGCGCGTCGTGCAGGCCGGCC
GGCCGAGCAGCCGTGATGTCCCGTGGACGTATGTCCACCTCCTCAAGTTCGGCACCCAGTCGGCCGACAGCGGAGACATC
GCCCGGGCCGTCGGCGAGTTTGGCCGCTTCCTGCGCAACAACCTGGGCGTGCCAGTGCGCGAACGTCCCATCCCGCTGCA
ACGCCATGAGTACAACACCCAGGCAGACCCGCTGGACGGTGAGGCCGCAGTGCAGCACGCGCTGCAAGGGCTGCAGCAGC
TGAAGCCGGCCGACCGTCCGCGCGTGGTGCTGTTTGTGCTGCCGGGCAACGCTGACAAGGACCTGTATGCGTCCATCAAG
CTGCAGGGCGACACCGTCTTTGGCGTGCACACAGTGTGCGTGATCGGCAAGAAGCTGACCAAGACGCGGCCGGGCAACAA
CTTCGGTGGCTTTGACCCGCAGTACTTTGCCAATGTCGGGCTCAAGTTCAATCTCAAGCTGGGCGGTGTCAACCACCGGC
TAAGTGACGATGTGAAGGATCTCGGGCTGCTGTCTGAAGGCAAGACCATGGTTGTCGGTTATGATGTCATCCATCCGACG
AATCTGGGTCTCGGTGGTTCGTCTGCGAGCAGCAGCGGCGATGCAGCTGCCACGCTGCCCAGTCAGGTCGGCCTGGTAGC
CAGCATCGACCGTCATCTGGCCCAGTGGCCGGCCGTGTGCTGGGAGCAGCGTGGTCGCCAGGAGATGGTCAGCGCCCAGC
TGACGGCGGCCATGCGCAGTCGCCTGATTCTGTGGCGCGAGCACAACAAGGCTCTGCCGCAGAAAATCCTAGTGTATCGT
GACGGCGTGTCCGAGGGCCAGTTTGCCCAGGTGCTGGACGTCGAGCTGCCGCTGATCCGTGCTGCCGCCAAGGACCTGTA
CCCGGCGAACGCACCGCAGCCGGCTGTCAGCATCATCGTGTCGGTCAAGCGTCATCACACCCGCTTCTTTCCCACGCAGA
GCGGCCACGACACCGGCAACATCTCCTGCGGCACCATTGTCGACCGCGGTGTCACTCTGCAGCGGTACTGGGACTTTTAC
CTGACCGCCCACACGGCCATCAAGGGCACTGCTCGCCCGGCGCACTACACTGTGCTCTATGACGAGATCTTCCGGCCAAA
GTTCCCCGGAAACGGCCAGGCTGCTGTAAACGCGCTCGAGACCCTGACCCATAACATGTGCTACATGTTCAACCGCGCCA
CCAAGGCCGTCAGCGTCTGCCCGCCTGCGTACTATGCCGATCTGGTGTGCACGCGTGCTCGTCTGTACCAGGCTCGCGAT
TTTGACCGCATTCTGGCGAGCCAGGCTGGCGGTGCTTCCGACACGGCCAGCCAGATCAGTGGGTCGACTGCGCTCACGAC
CATCGGGGCCCTGCCGCGCGTGCATGCGAATATCGAAAATGACATGTTTTATGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62