GenePrediction:GLEAN_2181 Details

Name: GLEAN_2181
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1239057..1244978 (+ strand)
Length: 5922
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1239057..1240326 (+ strand)
Length: 1270
Type: CDS
Source: GLEAN
Position: GCSC_108:1240521..1240615 (+ strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_108:1241958..1241994 (+ strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_108:1242312..1242334 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_108:1242398..1242438 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_108:1244499..1244648 (+ strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_108:1244756..1244978 (+ strand)
Length: 223
>GLEAN_2181 class=GenePrediction position=GCSC_108:1239057..1244978 (+ strand)
ATGATTCAGGAAGTAGCTTCCAATCTTGCAGACACGTTGCGCCGCCACGGATGGGCCTCGGAGCTCGCAGGCATCCTCCC
GCTCTCAGCCCTCATCGACTTTGTCGCTATCCCGCCCAAGCTGCACGTCCTCGAGCTCTCCGGTGCCGTCCCGCTTTGGA
GCTGGGTCATCACCCCGGCAGGTAGCCGTGTGCTACTTGCGAGACGGCCTCAGTTTGCTAGCCCGGGCTGCTGCCAGGAC
CGCTTTGGCACGACTATTGCGCTTGAGACCCTTGACGGCCGTTACGGAGAGCGTTACTTTGCCAGCAACCCCGAGACTCT
CCGCCTCGTTTTGGCCGCCCACCCTATCATTCAGATTGAGAATAGGCACGACAACATGACAACAGGTCTCGGCTCCGACT
TGCGCATACAAGCCCTAGAGGTCGTCCACATAACACGCCGCGACCCTAACCATTGTCCACTGCCTAGCAGCTCAATATGG
CGTCGAATCTTTGTTAATTTCCTGCGCAATGCCTCCTCCAGCTATCTTGCTATTGCCTTGTTGGGATGGGGTCTGCTCAT
TTGCACTGTTGTCGCGTCCTTTATCTTGGAGGCCTGGATTGCGTTGGCTTTTCTCTCACTTATTCCCGTTACGGGTGTCG
TTATCGTCGCCCTGTACGGACGCCAGCCACGGCAGCTACTTGTCGGCAAGCCAAGCATCTTTAACCGTCTCCTCGTCGTT
TCTGAGCACATGAACTCGACTGACTGGCTTGTCGTTTACGGCGAGAGCACTGTCGTCAACTCCCTCTTAAACCGACCGTT
AGAGCCGACTGGGCCTCCACTTTCTCCTGCCGTCATCGAGGCTTTCTACTGGTTGCTCCACATCTTCATCATGGGCCAAT
GGGCCCTTGCCCTTGGTGCAGCTGTGACCAAGAATTCGAATGCATACATTATATGCTTTTGGATTGCGTTCTCTATCTTT
TCTCACGTTTATCTCGTTACCCCCGAGAAAGGTGTGAGAGATTGGTCAAAAGGTTATGCCAATCTGCGAGTAAAGCGATA
TGGCATCAAGGTCAGCTCTCGCCGTGCCCTTCTCAATACTATAGTCGCATTAAATCCCGATACTTTCTCGGTTGATGAGG
CGGGGACTCCAGACATGACAAGCTTTCATAGCGAGGGAATCAAGTGGATCGATCCTGTTCTAACGCGGTCTGACAGCCGT
ACAATGTGGGAGAAGGCCACTCGGGAGGCCATGACCGAAGCCCAATTGCAGATAGCCGCAGTTGACATCTGTAAGGAGCA
GCTCGAAAACTGCCCGAATCTAAGCGCTGACTGGAACACAAAATACGCTGACCCACAAGGTTGTCATTGGAGGAGGTTCA
TATCCGAAGGACTCTACGTCGCGACAAAGATAAAGATGTCGGCGAAACTTCCTGGAAGGAAAGTAGTCCACGACTCTGCC
GATATTGGATGGCTGTCTTCCTAGCATATGCATGGACCAGGGACTGGGCCAAAGACATGACTTCGATGGTCAACGCTATC
CCTATGAGCCGCTGGATGGAATACGGAGGCAAGTCCGGAGTATGTTATTACAAAGGGTCTGTTATGAGTTGGTAGCGTCG
TGGACGTATTCGATGGAGTAGGATCAGCTACGCGGGTCGGTGATTTGACCTCTAGAACACCATCAACCCAGTGGGATAGC
TGCATAGACACATCTAAACTATTTATACTAAAATGCCAAAGGCACGGTGTACCATAGCCACTCCGTCTGTAACATTTATG
GGCCCCCGCGACTCTGCGCTAAAGAGCATGGACGAAGTGTACGACTTGGTGGGCACTTCATATGGAGATGTCGCCAAAAG
GTGCATCAGGTTCTGCTTTTCGGGTCAGGACAGTCACAACACGTTTGAGATGGAAAAGTTCTGGGCCACGTTCTACCGCG
ATGTCGTGGCGCCTCAGGCAACGTACATCAGTTTTCAATAATAGTTGATCAGCCAGCATAGATTACTACAAATGGCTTCG
AGACATCCCGTAATTCTGCATTGAGTGACGAAAATGATTCTGTCACTGTACTGTGCTATAATGAACGGTCAAAGGCCTAC
TCGTAGAGAGGTGCGACACTTCTTAAAGGAGTAGGCAACGACGTGATATTTGAGAACCCTAAGAAATGGATCAAGCTTCA
TCTTCCGCCTTTAACCTCTTTAATTTGTCGAGCGTCAGAGATAGGCTCTTCCATTCGCTAGACTAGCCCAGTAATATTTA
CGCAGTGTGTGTGTACGGATTACGACGACGTACGGACTACTTTTGGGGAATTCTGTACTCCGTACTCCGTAGAGGTCCTT
CTTACGAATGCGATATCTCCGACCTGCAATACCCACCCTTGAAAGCACGCGCACTTAACGTAAAATGCAACCGGGCCCAC
CAAGACTGCTGCCTTAAATTCATGATTTCCACTAATTTCAGTATTCGGCATATCTCCGTCTCCATGGTGTATACCGACTA
ACCGTATGGGCTACAAGGGCCGTCCTACTGGCCTGATTCCACCAATACTGTGGAACTGCTCCTCTTGCTTTCGTGTGATT
CCGAACCTGTTCGTATGCAAGATAGTTGGCCTACGCCTTCCCCCTCTTTCTCATTATATCTCTTCTCCATGCCTTGGCTT
TTTTGTACCAATATAAATGCGCAGCTCTTCGTCTGCCGTTCTCCGCGTTATGCGTTAATACAACAAAAGCAGTTGCAGCC
ATGTCTTCCAGCACAGGCAGCGGACTTGCGCTGGGACTGGTTAGTCCTGTTGTGGAACTGCCTATAATTGACGAGCCCTT
ATTAGCAGCCGAATTGTTAGTCGGAGAGTATGTATGTAAAGAGGAAAGGGAGGAAGAAAGGACTCTATATTTGTGCTTAT
TATTCTAGGGCGACGGTTTAGGTGAAGATTCGGACTCAGCTCTTGGCGATGATGTCGCGTATGTTTCCACCCCAATCGCT
TCTAGGCAAATATTTGTCTCTGGCCGATAGAAAAGAAAGCTTACATGCTTAGGCTTTCAACGGCGTCTGTGTCGAGCAGC
ATCTTGCAGTACCGCACATTGCACGGGCGGACCTTCCACAGCGATAAGTACGAAAATTACTTTATGCCTAATGATGGCCA
GCAACAAGAATCAATGGATATAATGTATGATTTGATTATTGGCTGTTTTAAGGCCGTTGCCTAGTTTTATAGCTAACACG
CTTATATATAGACACCACTTCTTAACGCTATTACTAGACGGTGCTTTATTTCTAGCGCCTATCACCGACAAGGTTAAAGT
ATGTTTGAGTTAGAACATAACTGAATATATATATATAACTGACAGGTTCATCTATAACTAGAATGTGCTTGATATTGGCA
CTGGTACTGGCACTTGGGCAATGTAAGTGAAAGTTTGATATACACCCTTTTTGTCTTAGTAGTTTATTTATAGAATGAAT
ACGGCCAAGATGTTGAAGATATGGCAGTAATCTAAGCCACGATACGGGCATGTGGAGAAACGAATAAGACTGACTTTATG
TTTGTTAGCGACATTGGCGATCAGTTTCCAAACGCCCAAGTGCTCGGCACTGACATCTCACCGATCCAGTCAACTTGGGT
GCCGCCAAACACTAGGTTTGAAGTTGATGACGCCAATCAGCCATGGACGTGGAGTGAAAATACATTTGATTTTATCCACA
TTCGCTACATGGCAGGGGCTGCAACGAATTGGGAATCACTTTTTGCTGAAGCCTACCGTTGCTGCGAACCAGGCGGCTGG
CTTGAGTCGTGCGAAGTGCACCCCGAACACCAAAGTGACGATAAGTCAGACGAGCTAGCCCCATGCTTGAATCAATTTTG
GCGACTCTACGAAGACGGAATGCCTAAGCTAGGTCGACAGTTCCTTGTTGTTAAAGAAGGCATGCAACGTAAGGCTATGG
AAAAAGCAGGGTTTATGAACATTACAGAGAAGAACTTTAAGCTGCCTGTAGGCGGCTGGCCTGCGGATAAGAAGATGGCT
GAGATCGGTCAGTATGCTTTGTTGGCCTTGCTAAGCGACCTGGAAGGTATGTTCCTTATTTTCGGCGATCTTCTTACCCC
CTGTCCGATGCAGAAAAATCGTCGATGCGTCCAAGATAGTTGACTGCATACAGGATACACTACCTTCCTGTGGAACGACG
TCTTAGGATTGGGCGAAGCCGAGTATCAAGTGTTTCTTATGCAGTTGCGCAGGGCTGTCAAAGACAAACGCATACACACA
TATTACAGTGTCCGCTACGTCTTTGGACAAAAGCCGTCCGTGTAATAATTCTATGCAGCAGGCTTGCTTTGGTAGATAAC
ACAAGAGTTCGGAGATTTGGTGCGTCTAATTATGTGTATGAAGCCTAACAGATGAAGCTTGACTCCCTCCAACTGCCGCT
GGGCGCGGATGTGATCACCTGTCTGACTGCGCCCGCCGCTTTGTGTTGTGTATCCAATAGCTGCAGGCAATACGGACGAA
GAACACTGGATAAGGGTTGTTGTGTGTCGCCTGTAACGTCTTGTAGGTAACCATCATTAGCACTTATAAACGGATTCTAG
GAGCGATTTCCTTGCCCAATTGTTGCCTCCGAGAGCACGCATGCTCACTAGGCGCCTATAGCATCACAATAGGAGGCCTC
CTCATATAAGGCAGATCCTTACTCTGCACTCCTGTAAAAATAGCGGCAGCCCCAACCAATTACCTCTCGTTGCAAGGAAT
AACGACCTTGCCAATATGCTTCTGCTGCCACGTCTACATCTGCTGCGCCATATTGTAGTACTGCGCCAGTGACCGAATGA
GGACTCAGCGCACGATGGCCGCACGGGGCAGCGCGTTCATGGTAGCCGAACCGGGGCTGTTGCAGCTGGAGTCGAGGAAG
CCGACCATGGCAGTCTCGCCGTCGGGTGTCAGGCCGCGGGCTGTCTGACCTAGGCCGGGTCTTCGCGGTAGTTTAGCGAG
ACAGCTTTGACTTCTAGCAGGATGTCGTACGGGCAGCCACAGGCGGAATGGGCACAGATCAGGTTAGGCGCAGCACGAAT
CGGTCCTCAAGAAGCCACTCGTCTGTGTGCGTTGGCAGAATCATGATGTATACGATTGCTTGAAGGGTGGATGTCGAGGC
TGCTTTGCTTGGATACGATCCTCGTCTATCCGGGAGCAATGCCTTTCAGCTCCTTGGAACCACCGACAATAAAATCCGCA
ATCCTATGGATGTACTTGATACTCGGCCCAAAAGGAAAACCTGAACACAATCACAAAACATAGTGTACAGTCGGGATATA
GCGTCTAGCATATAGCTAGTGACTGCCCCGACACATCCTTCTTCAGCTCTGCGACTCCCTTGCACACCTCTTACCCAAAT
CTACTGTTGTTGATCTAGAGTGATTCGGACGGGAGTCGTTATCTATCGCCTCTGTCACGATGCTCTTTGTGCCGCTGTGC
AGAGCGACGGAACTGCACTGGAACGTTTGCATCCTGCGCCGTCTGGACACGGTCGTCTCGCTGTACCGCTACACGCACGA
TCTGCCTGACCCAGAGGGTTCTGATGCGGTAGTAGCTGCCACTGGTGACACCCTCGTTGCCCAGGTCTTGACGTAAGCGT
GCACGAATGCCCGCGATGCTGCAAAACCCGGGCGAAATGGGTGTGGCAGTCGTGATACTGCTGCTGCACGCCATCATCGG
CCGTGACTTGCCATCACAGAGCCTCGACTACTGGGTCTGGCGCCGGGCACTGGTACACCATGTCGCGCGTGTCTCTGTGG
CAGTGTGGTGGTAGTGTCGGCACGGCGACGAAGCAGGCGGCCAGGAACATTGCTTTGGCTATGGAGTTTGCAGTCACGCA
CACAGGCCAAGCTGCACGCCGGGATGTCTACCTACGCAGACCGTCCAGACACGAGCTATATGGACGGCCGTTGCAACAAT
AA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62