GenePrediction:GLEAN_2182 Details

Name: GLEAN_2182
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1246940..1248419 (+ strand)
Length: 1480
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1246940..1247103 (+ strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_108:1247175..1247474 (+ strand)
Length: 300
Type: CDS
Source: GLEAN
Position: GCSC_108:1247591..1248419 (+ strand)
Length: 829
>GLEAN_2182 class=GenePrediction position=GCSC_108:1246940..1248419 (+ strand)
ATGGAAGAAGTTGTCCAGCTGCTTAACGATACGAAAAACCAAAAACTGGTCAAGGAAATTCTGAAGAAACGACAAGATAA
AGACAAGCAGAGGGTCACGGTATCTATAGCAGATGTACTGCCGTGCTATTTCTTTGACTTTATGATTGGCACTAGCACTG
GCGGGTAGGCTGCATTGTCTCCATGTCTGTAAGCCAAGCCGAGCGTCTTTGCGTTGCTGACAGTTCGCCCCCTAGTTTGA
TTGCCGTTATGCTTGGGAGGCTGCGGATGGGCGTCGACGACTGCATAAAGGGCTACTGGCAGCTCAGCAACGTCATCTTT
ACGGTAAAGCCCTGGCACAAGTGGCTATTCAGTTCCACAAAGCTCGTGAATGCCATCAACACGGTAATTACCAAACACTG
TCACTGCCACAGTGGTACGCAACAGTGCATTGGTCATGAAGAGGAGTTTAGGCAGTATGACTATGCAGAAAATCGAAAAG
ATGGAGAAGATGGAGAACCAGTGGATCCCCCCCGTATAAATGGCACTTGCAAGGTGTAAGTTCTTTTCTTCTGCTATCTC
GCTATTCATCTAAACAAATTAAAAACAGGGCAGTTGTCAGTCAACGCAATGGCAACCCTACCCGAGAAACCTTTTTCTGG
CGAACATATAGCCACCATGCGCGGTACCCAGAAGGCGAAGCACTGCTCGAGCTCAATCCCAAGTCCCTTCACAAAGCCAA
GGCCAAAATATGGGAAGTCTGCCGGGCAACCACAGCCGCACCTTTTTATTTCAGAAAGATCCGAATAGAGAAGCACAAGC
ACATGGATGGTGGCGTCGGAAATAACAACCCGGCCGACCTTGCCTGGAATGAGGCGATCCAGATGTATAGCCCGGACGAC
CCCAAGCATGGCAAGGCGTCGCTTCTGCTCAGCCTGGGCACGGGCCAGTCCAAAGTTGAGAGCCGTTTTGGCAAGTCTAT
CCTGTCCCTAATGTTCTGGGCAAAGAACGGGATCACAGAGACGGAAGGCACTCACCTGTCCGTCACCACCACCACCAATG
CTGCTCGTGCTGCGTATTATCGCTTAAACGTGCCTACTGGACTGTCGGATATTAAACTCGGCCACTGCAAAAAGAAGGCA
AGAAAGCCGTTTCTGCCAAGCTGGACCAAGTCACCGCCGGGTCCTGACCCAAATGGCACTCCAGAGTGGTACATTGGGCT
GCGCGAAAACGCAACCGAGAAGGGAGCCGGCTCGTTCAGGCCGGACCAATACCATTACAGCACATTCGAGAAACTCTTCC
AGCTCACCAGAAAGTACTACGAGAAAGAAAGGTACAACAATGAGCTTACCGTCGAAAAGGTCATCCAGGACTGTGCCCAG
AGGCTTGTCAACTGTGCCCGGCTGAGACTGGAAGCGAACCCGGAGAGGTGGACGCGGTTTGTGAGCCATCCGGACCCAAG
CCATCCACTATCCCTGAAGGCAGAGTCGGCATTGCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62