GenePrediction:GLEAN_2183 Details

Name: GLEAN_2183
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1256774..1258389 (+ strand)
Length: 1616
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1256774..1256986 (+ strand)
Length: 213
Type: CDS
Source: GLEAN
Position: GCSC_108:1257070..1257206 (+ strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_108:1257262..1257303 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_108:1257367..1257433 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_108:1257495..1257535 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_108:1257597..1257698 (+ strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_108:1257751..1258099 (+ strand)
Length: 349
Type: CDS
Source: GLEAN
Position: GCSC_108:1258156..1258389 (+ strand)
Length: 234
>GLEAN_2183 class=GenePrediction position=GCSC_108:1256774..1258389 (+ strand)
ATGATGGCTGGGCCCAGGACTTCTTCGCCACCCCCAGCTGTAGCCACCCCCCAAACTCAGACTGTACCGACAGAGACTGT
TCCTGCCAAGGGCACGTCTGGGGTCATGTCTGGGGGCACTACTCCTCCCACAGTCGTCACAGCCGCCACCGCTGACCCGT
CAACTTCACAGACTGTTACTGACTTCATCGAGGCTGTTGACAATGTGCCTGAGGTATGCCTCTGCGTCTGGGCTCAACCC
CACTCTATTTGCTCTCTTGTTCCGATGGCCAGGTTAATAATAGGTCCCTCTTGCAGGCAAGCGACAGCGACGCCGACTCT
ACTATGGGAGACGAACATTCATCCTTTACAGCATCGATCACATCATCTATCGTAAAATATCGCACGCTTAACGGTCGGAC
ATACCACAGCGATTCCATAGGAGACCACTACTGGTACTCTTCACAGATTTCTTCCTTCCTCCAATCCGAAAACGCTGACG
CATTACAGGGGCTCCAATGATCAGGCACAAAACAACCTTCTTGACATTGGGTGCGAACGATACGCAGTCCCTTTCCCCTC
GCGGAGCCAAGGCTGACAGCTAACAACATTCAGGCACCACGTGCTCACTTTGCTACTAGATGGCAAGTTGTACGGGCCGC
CGCTAAAAGAGCCAATTGAAGTAGGGCCTTACATATTTTCCATATCGCGAAGAATGGTACTGATACTCAAACTCCCCGAA
GAGAGTTCTTGACCTTGGTACTGGCACAGGGTCCTGGGCTATGTATGTCTTCCCCCTCCATGCGCCTGCTTCCGTCGGCT
CCAAACACTCACATTCATATTAGAGACTTTGCCGACGCGCATCCCGAGGCCGAGATAATCGGCACCGACATATCGCCCAT
ACAGCCGACATGGGTGCCGCCCAACGTGAAATTGTGCTATTTCTCGTATGTCCCTGAAGCTAGGTGTGACAGAAAGCTGA
CGGCTGGGTTTCCCTAGTATGATTGACGACTTCAACAAGCCTTGGCTTTTCCCGGAAAACCACTTTGACTTTATCCACAT
CCGATGGGTGCCTGGCACCGTCCACGATTGGAAGTGGCTGTTTGAGCAGGCTTACCGCACCCTGAAGCCGGGCGGTTGGC
TTGAGTCATTGGACAACGACGGATTCTTCCGCAGCGACGACGGTACCATGAGCGAGACCACGGCCACCTACGATTGGAAA
CGTATTGCTATTGAGGGTGCCAAGAATATGGGCCTCAAGCCGTCGATTTGTACGGTACTAGATGACCTAACGCGGCCAGC
CATAGATGCCGCTGGATTCGTCAACATTTCCGAGACGTCATATAAGGTGTGTTTATTTTGTCTTCCTTTCTTGTATCAGT
GTCTGCCTTCCTAACATGGCAGGTTCCCTACTCGGAATGGCCCAAAGACCCCAAACTCAAGGAGATTGGGCTGTACTGTC
GCGCCATGCTGGAAACTGACACAGAAGGCATGATCGGCCGACTGGCAAACGCAGTGGGCTTCACGCCGGAGCAGACCACT
ATCTATTCCGCGCTGGTACGAAAGGAGATGCGCAGCCTGAACGTGCATGCCTACTACTGTGCAAAGCAGGTGTACGGCCA
GAAGCCAGAGGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62