GenePrediction:GLEAN_2184 Details

Name: GLEAN_2184
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1263659..1265139 (+ strand)
Length: 1481
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1263659..1264319 (+ strand)
Length: 661
Type: CDS
Source: GLEAN
Position: GCSC_108:1264400..1264494 (+ strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_108:1264711..1265139 (+ strand)
Length: 429
>GLEAN_2184 class=GenePrediction position=GCSC_108:1263659..1265139 (+ strand)
ATGTCTATCATTACAAAACTTCCGTGCGAAATTGTCAACGCAGTGTTGCAGCATGTTGGTAGCTTGCAGAACTTGTCATC
GGCATTGCTCACTTGTCACCATGTCCACACCAGCTTCCAGGAAAACCCACACGTCGCAGCTGACATTTTGCAGCGACAGA
TCGCCCCAGAGTTGCTCCCCTACGCAATTGCAGTGATGGAAGGATCGCGTCTTGGTCCACGAACCGCCCCAAAGGTCCAG
ACGCTGCTCAACAAGCTTAACGGTGAACTGTACACGGAATCGCAAGAGGCGCAAGAGTTTCAGATAAGGACGCTTGCAAG
CCAGTTGGCGACGATGCCGTTCCCACTGTTGTCGCAGATGAGCCACACACACGACGTCATCCACAGCTTCGTAATGGGAT
TTTCGACCAGTGCATGGACACATCTGTCTTCACGAATCTCGCCTGCACAAAGCGGAGAGAGCGTGTCTCTTTCATCAAAG
GAATACATTCGTTTCTGTCGCGCCTTTTACCGGATGGAATTGTACTTTCGCTACTTTCCACGCTCTGACTCACCAGATGA
AGAAACGAGTTGCGGTGCCTCGTTTTTGCGGACGTTTCCGGCGTGGGAAAACGAGCAGATTGGTTGCGTGCAAGACTTTT
TCGAACTTCAATTTTCAAAAGGTGCCTTCATCCTCTTTGACCCTGTTCTCTCTTACGGTATTTTGTTCTGATTTCTCGTG
CTAACATATTCACTCGCATAGCCTCCCGGGACATTGTTGCGCATGACGTTTTCTTTGGCGAGATGAGCGTGGACTATCTC
ACTCCGGGCTACATGAACTATTCAAGACAAACTTGGGTAAGAAATAAAACGAAGGCCAAACCCTTACTCCTTCAAAGTAC
GTTTTTGTTTGTTTGCACATGTACTGACTTGTGTGATATGTCTTTCCAGCTAGGCCAGAGCCTTTGTTTTGTCCATCAAC
TCCTGATAGAAACGACGTACGATGCCAAGCATCAACTCTTGGCGTCTACGTTTACATCCGACAGAACGGATCTGCACGAG
ACACTCCTACAGCTATACGCGGAAGACCGACGCGTCAATGATACGCCGCTAGAAGACTATTCCAAAGAGAAACGAGACGC
CCTATTTGAACCATCGGAGCCTCGGCATGATGTCGACAGGGGCCCCTTTGAGGCATGGTGGGCAGCTAACAAAGAACTGC
CCCTCCATAGCTCGCTCATGATGAACCACAATGCTGGATTCCGGGAACAGGCATATGTGCTCTGGGATGAGGACCGCCTG
AAACGGTACAGCCTACTCGAGTTGTTTTCTGAAACTGCACCTGAGTCAGAGCTAGAGCTGGAGGATACAGAAAATGAACA
CGATGTTATGGAAAAGTCATTTGACGCCAGGTCCGAAATCTACCAAAAGGGCGGCCGAGGATACTGGAGCAATGATGACG
AACATAGGATTTCATGGCCAGAGGGATTCAGTGGGCAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62