GenePrediction:GLEAN_2185 Details

Name: GLEAN_2185
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1266205..1267325 (+ strand)
Length: 1121
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1266205..1266212 (+ strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_108:1266272..1267325 (+ strand)
Length: 1054
>GLEAN_2185 class=GenePrediction position=GCSC_108:1266205..1267325 (+ strand)
ATGCCGCTGTACGTTCCCCTGATCTTCTCCTGTGAAAGCCGAACTGCCAGCTAACTGGCGCACGAAGGAAACTTCTCGGA
AAGAAGTCGTGGAACGTGTACAATGCAGCGAACATTGAGCGAGTCCGGCGCGACGAGGCCGAGGCCCGAGCACGCGAGGC
GGACGAGGACCGACGACGCAAGGAGACGGAATCGGCGCGTCGTCAGGCCATCCTAAGAGGCGAAGCGGTGCCAGAAGAGG
ATCAGACAGCAATCAGCGGGCCCTCTGGCTCTGGTGCATCTAGCAGCGCAGCGGCTGCCGGGAGCCAGCGGCCGTGGGCG
GCCAAGAAGCGCAAGCGACACGGCGAGGACGACACAGACTTTGAGATGCGGTTGGCGCGGGCAGAGATGGAGCCAGGCAG
CCTGGAGGCTACCGGACCAGTCAAGAGCAAGAGCAAGAGTGGCGGTGCGGCCAGCCGGCCGATCGTGGACGGTACCGGCC
ACATCGACCTATTTGGAGAGGCACCCCAGCCGTCGGGGGGTGGCAGACAGGCAAGAGGGCCACCGACGGATGGGGCGCTG
CTCAACATGCGGTTCGCCGATGCGGCCGGCTACAACGGCTCGTTTGAGGCGTGGTATGCCGGAGGTGGCGACAAGGCCAA
GAGACAACAGGCTGAACAAGAGCCGAGACAGCAACAGCAGCAGCGGCCGCGCCACCCGCCGCTGCCATCGTCTGTGCTGG
CGGACCCGCTGGCGGCCATGCGGCAGGGCGCGGCAGCTGTGCGGGCGCTCACGCAAGAACGGAAGCGAGAGACGGAGGAG
CGGGCAGCCGACATGGCGGCGATGGAGGCCGAGGAGCGACGGCAGCGGCGAGAGCGACGACGAGAGCGGCGACGACGACG
CGAGGAAAAGGAGCACGATGCGGACGACGGGACAGAGGGACGACAGAGCAGGCGGAGACACCATCGACACGAAAGCGACA
GCGACAGCGGCAACAGCCTCGAGGACTTTTCTCTACAGGGCGGCCGCAGCAGCGAGAGTAGACGTCGACACCGGTCGCAG
GACAGACGGGCAGACAAACAGTCCAGGCCGGACGACCGACATGCAGACAGACATGCACGGGAGAGGAGCCACAGACGCTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62