GenePrediction:GLEAN_2187 Details

Name: GLEAN_2187
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1275600..1276306 (+ strand)
Length: 707
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1275600..1275952 (+ strand)
Length: 353
Type: CDS
Source: GLEAN
Position: GCSC_108:1276007..1276159 (+ strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_108:1276225..1276306 (+ strand)
Length: 82
>GLEAN_2187 class=GenePrediction position=GCSC_108:1275600..1276306 (+ strand)
ATGTCTCCCTCCTACGGCTCTTCAATGTACACGGAGGCTCTTCCTATGCCCGTTCCAGCAAAAGACGGGTATGCGGACTA
TTACCAGGGCTACCAAGGCTACCAAGGAGGTCACAGCACATACTCTGTTTCACCACCGGAATCAGAAAATGCTGTCAGTT
CCGCATCTGGTGGTGTCTCTTACAGCAGCCCTGGTTACTCTGCCACAGCTAGCTATGCTGGTAGCATGCATGGCGACTAC
GAAAGCTCAGTGTCTGCTGGCGGCGTGGACTTCAACGAGTACATGCAAGATCGCTTCAGTAACGCGTTCGACCCCATTCC
GCTGGACATGAGTGTCGCAAAACAGGCACACACGTGAGCAGAGCTGGAGAATGAGCAGAACTTGATTCGTTACTGACATA
CAAACAGGTCTGGTCTCTTGAATGACAAGCAGCGCCAGCTGCTGGAGCTGCAGCAAAAGGCGCAAGCGCGTCTTGCCAAG
ATGCACACGCGGTTCGCCGAGGGAAGACAAGATGCACGCGAAGTGCGCGCCAACCTTGAATGGTCGCAGAAGAAATTGAC
GTAAGTTGTTGCAGACGCCTGACCTTGTGTGAAAGCAATGGACGCTGACTTACGACAAAAAATAGATCGCTAAACGCAAA
AGCGTCAAAGAAGCACTCCAAGGAGTACAAGAAGGCTCGCGAACGGTACCCTTCCCCAGAGTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62