GenePrediction:GLEAN_2191 Details

Name: GLEAN_2191
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1296027..1297147 (+ strand)
Length: 1121
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1296027..1296367 (+ strand)
Length: 341
Type: CDS
Source: GLEAN
Position: GCSC_108:1296700..1296950 (+ strand)
Length: 251
Type: CDS
Source: GLEAN
Position: GCSC_108:1297011..1297147 (+ strand)
Length: 137
>GLEAN_2191 class=GenePrediction position=GCSC_108:1296027..1297147 (+ strand)
ATGGCTTCTGCAAAGCTTACAGCGCTTCTATCCTTTCTCTCCGACATACCTCGATATAGGACTGAAAAGCCATTTTATGA
ACTTCGTCGACCTCCTGCTGGATTTGATTACGAAACAGCTACTGAAGCCGAGCTGGAAAGTCTCGCCAAAAAAGACAATC
TCGAGTTCTCCGAACAAGATGTGCCTATTGGTAATATCCGTGGAAGGGAAGCTAACTTCCGTCTGGAGACCTGCGGCTTT
GAGATTGTGCATCATGCCTCCCGGCTGACAGACCGGCTCATGATGTCCGCAGAAGCCATCCAAGCTTACAAGAACGAGAC
GGAGGAACTCTTGCAAAAGAGGTACAATGCGGATTATGTTTTTTGCTTTGAAGCTCGTGTCAGTTCACCATGGCCTGCAC
CCTGAACTCAGACTTATTTAGGGCATCTATAACCTATTGTGTAGTTGCGAAAGAACCAGCAGTTCTCTAGGCGTGTGTAC
GATCTGTCTGACCCTCTTCTCGTCGAAGGTCCTGCTATTGGTGCACACACAGATTTTACAGTTGACAGCGGTCCACGATC
GATAGACAACTATCTTTCCGACGAGGCGAAAGCGACATATCTCACCAGCCCAGGATACAGGTTTCGCATTTTCAAGTAAA
ATTGCACAACATTACATGTCACTCTGCCCACAGGCTAACAGGTCCAAGCACATGGCGCGGTCTGATTCCAGAGATAGAAG
ATAACCCTCTCGCTGTCTGCGACTACCGAACGGTAGACAATGGCGATCTGATCGCAGGAGATCGACTTATTCCTACCAGG
ATTGGCGAGATTTACTACGTCCGGCACAACCGCAATCAGAAGTGGTACTGGCTCGAGAAGATGAAGCCAGACGAACCCTT
CCTCATGATTATGTACGACTCGGATGGGGGAAAAGGCGCCTTATGTTTGTAGATCCATCCGTTCGTGTTGTTTTTCTTAC
ACGAAATCACTGACACTACAACAGTGTGCCCCCATATCTCCTTTCAAAATCCTGAAGCCCCGGAAACGGCCCAGGAACGA
GTTAGCATTGAGACTAGGACCATTGTTATCACAAGGAGGGAAGAGGAGCGCCTCTTGAGCGACCACATATCCTCCTGCTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62