GenePrediction:GLEAN_2193 Details

Name: GLEAN_2193
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1310102..1312509 (+ strand)
Length: 2408
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1310102..1310365 (+ strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_108:1310416..1312335 (+ strand)
Length: 1920
Type: CDS
Source: GLEAN
Position: GCSC_108:1312393..1312509 (+ strand)
Length: 117
>GLEAN_2193 class=GenePrediction position=GCSC_108:1310102..1312509 (+ strand)
ATGGCCGAGGTCGCTTCTTCCAAGAGAACAAAACGCAATAGCATCGACAGCGACGGCGAAGCCAAGAACATGAAACGCAT
AAAGACGGAGGGCGACGGTGCGGGCAAGAAGAAGGTGCCCAAGCTCGAGAGCAGCAGCGATGCATCCAACCCGTACTTGG
CACACCTGTACGAAGGCGGACAGGACGCGTACGGCGGCCAGTCGTCGGACAGCTTCTTCGCGGGAATGACGCCACACGAT
ACGACGGCCGTGCAGGCAGCCAAGGTGGAGGACATGAAGATTTTAACGCCTTCACCGGACGGCCACACAAGCAGCAGTAC
TTTCAGATCCTCGAAGGACGGCGCAACTTGCCAGTGCACAAGCAGCGACAGGAGTTCCTGAAAGTGTTCCACTCGACGCA
AATTCTCGTCTTTGTGGGCGAGACCGGCTCGGGCAAGACGACGCAGATTCCACAGTATATTCTGTACGACGACATGCCGC
AGTTCAAGCGCAAAATGATTGCGTGCACGCAGCCGCGACGGGTGGCAGCGATGTCGGTGGCCCAGCGTGTGGCAGACGAG
CTGGACGTGGAGCTGGGCGAGGAGGTGGGCTACAGCATCCGGTTCGAGAACCGCACAGGGCCGAAGACGCTGCTCAAGTA
CATGACGGACGGCCAGCTGTTGCGCGAGTGCATGAACGACCCCGACCTGACGCGCTACAGCTGCATCATGATCGACGAGG
CGCACGAGCGCACGCTGGCGACAGACATCCTGATGGCGCTGCTGAAGAACCTGTCGCTGCGGCGGGCCGACCTCAAGATC
GTCATCATGTCGGCCACGCTGGACGCACAAAAGTTTCAGCGCTACTTTCACAATGCGCCGCTGCTAGCCGTTCCTGGTCG
CACGTTTCCGGTGGAGATCTTCTACACGCCCGAGCCGGAAAAGGACTACGTCGAGGCAGCCGTGCGGACCGTTCTGCAGA
TCCACGCAACCGAGGGCGAGGGCGACATTTTGCTCTTCCTGACGGGCGAAGACGAGATCGAGGATGCGTGCCGGCGCATC
AGCCTCGAGGTCGACGAGATGAGCCGGGAGTCGGATGCGGGCCCGATGGCTGTGTACCCGCTGTACGGCACTCTGCCGCC
GCATCAGCAGAACCGCATCTTTGACGCGGCACCGGCACCGTACAAGAAGGGCGGCCGGCCAGGCCGCAAGTGCATCGTGT
CGACGAACATTGCGGAGACGAGTCTGACGATCGACGGGATCGTGTATGTGGTGGATCCGGGCTTCAGCAAGCAGAAGATC
TACAACCCGCGGATCCGGGTCGAGTCGCTGCTGGTGACGCCGATCTCGCGGGCTTCGGCCCAACAGCGAGCCGGTCGAGC
TGGACGAACGCGTCCTGGCAAGTGCTTCCGGCTGTACACGGAGAAGGCGTTCAAGCAGGACCTGATCGAACAGACGTACC
CGGAGGTGCTGCGGTCGAATCTCAGCAACACGATCCTAGAGCTCAAGAAGCTGGGCGTCGACGATCTGGTGCACTTTGAC
TTTATGGACCCGCCGCCGCCGGAGACGATGATGCGGGCGCTCGAAGAGCTCAACTACCTCGCCTGTCTGGACGATGAGGG
CGAGATGACGCAGCTGGGCAGCACAGCGTCGGATTTCCCGCTGGACCCGTCGCTGGCGGTGATGCTGATCACGTCGCCCG
AGTTTTACTGCTCCAACGAGATCCTATCGATCGTGTCGCTGCTATCGGTGCCGATGCTGTTTTTGCGACCGGCAGCGTCG
CGCAAGCGGGCCGACGAGGCCAAGGCGTCCTTTTCCCACCCCGACAGCGACCACCTGACGCTGCTGAACGCTTACCATGC
CTTCAAGGGCGAGGAGCTCAAGGGCACCGACATGCGCAAGTGGTGTCACGAGCACTTCTTGTCGTACCGCCACCTCAGCA
GCGCCGACAACGTGCGGCTGCAGCTCAGGGCCATCATGGAGTCGCGCGAGGTCGAGCTGGTCAGCACCGAGTGGGGCGAC
AAAGACTACTACACCAACATTCGCCGCGCCCTGTTGGCCGGCTTCTTTATGCAGGTGGCCCACCGCCAGGCCTCGGGCAA
GATTTACCGCACCATCAAGGATAACCAGGCCGTGGTGATTCACCCGAGCACCGGCGTGGCCACCGACTTCGAATGGGTCT
TGTACAATGAATTTGTCCTCACGAGCAAGCAGTACATCCGGACCGTGACCGGCATCAAGCCGGAGTGGCTTTTGGTGAGT
CCTGTTTCGGCGCACGTGATTTGGCGTATGGCTCGCTTACTAACATTCCAGGACATTGCGCCCAACTACTACGACCTGGC
GGCCTTTGAGGACGGCGAGGCCAAGGCAGCCCTCAAGCGCGTGGCCGAGAAGACCCGCCGGAAGGAGGCGGCTCGGTCGG
GGAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62