GenePrediction:GLEAN_2194 Details

Name: GLEAN_2194
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1318106..1320968 (+ strand)
Length: 2863
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1318106..1318260 (+ strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_108:1318319..1320968 (+ strand)
Length: 2650
>GLEAN_2194 class=GenePrediction position=GCSC_108:1318106..1320968 (+ strand)
ATGGACTCGACTGCTCGGAACAACGAGGAACGGCAGGCCCGTCAGACGCTAGTGGAGTCGCTCGTCAGTCTCGGCACGCG
GGCGTTTGACCCAGATGCCTCTGACGGACAGGCTGTCGCTGCCAGCCGCCAGCAGTTTTCCGAACTCGTTCAAGGGTCAG
AAATACGTCGCATTGTTCAAGTTTATAATTCTCGTTCCTTTCTGACATTTCAGCGTACAACCGGTATCCCTCCTGCCGGC
GCTCAACGTGCTCATCCAACCGGGCCACGTGCCTGAATGGCTACGAGCCGAGTTGACCAGCACGTTGGCCCTACTGCCAC
TGCGAGCTGGTGGTGTGCGGGCAACGCTAGAGTTTGTCTTTTCCGTGCACCCGGCGGGCGGCTCTGCGAATGCCGCGGCC
GCTGCCGCTGCTCCTCAAACAGAAGGTGCTAGTATCACGCACGAAGCGCTCAAGATGGCCACGCGCCTGCTCGCAAGTCC
GCCGGCGCGAGCCACGGCCTCCAGCTGGTTCGAGGGCATTGCACCACAGCTAATGTCGCTGCTCGACGGCCACGACGGCC
TCGAGCTAGCCAAGGTGGCCTCGTACGTCATCGGTTTCGGCATCCTCGGTCGCAAGAGCTTTGGCGCTCCTGGCGCTCCC
GGGTGGAAGCACTTTGCAGAGCCCATCCTGGCGGCCATCGATCCGACCACGAGCAGCAGTAGGTCCAGCAGCCGCGGTGG
TGACGCCGTCGTGGACCTGCGCAGGGATGCCGTCACGGTCTTGGTGCCACAACAGGAGGTCTCCCGCGGACTCCGGCGAC
TGCAGACTTTGATCATCTCCCATCCTAACCCGGGCCTCACTCGGAGACTGCTGGGACCTCTTGTGCTGCCGCTCTGGGCT
CTGTCATCATGGCCTCAAGGCGTACGGCAGATCGAGGACGAATACAGCTTGCCGGCCAGAAACCTGTTGAGGATTTACCT
CAGGATATCGTTCTCGGGCGAAAAAGTCCTTCCTATGATCCAGAGTCTCCTCTTTGATGGCCCCCGCGATCCGACAAAAA
AGCCCCAATGGATCTACCAGGTTGCACAGTCGGGAGACGGAATCTGCATTGTGACCGCCCCCATCGACCAGCCTGATGTT
GCCGAAGTGCTGCAGTCCCGACTGCACGAGATAGAGCCCAAGTGCGACGCGCTGCTAAACATGCTAGTAGCCATCTCGAC
GGACGACGATGCCATATCCACCGTGTTCTTGACTCTGTTCGCTCGCCGGATGTCGGCCAAGAAGCAGAAGCAGGGACCGA
GGGCAGCGGCAGACGTGGTGTTGATCAAGCAAGAGGACGAGGACGAGAAAGAAGTTGTGGCAGACGACCCGCTGGCCGAG
CTCCTGGAGAGCAGCGTTCTGCAGCGAGTGATGGAGAGGTTTCCGGAGAAACTGGCTCGCCGGCCGCAGGACATTGTGAA
GCTGGTCGAGGGCATGCTGGTGCAGCTGGATGAGGCGGATGACTCGACCGCCGTGGCGCTGAGTCTGCTTAACCTCGTGG
TCACGGCGCCGGGCTTCCGCAAGGCACAGATCGCAGCAGCGACAGTGCAGTCGATCGAGGCGTCGCTCGAGCGAATTAGC
ACACATTCAGGCACAGGCACAGGCGCAGTGGCCGAGACTGCGGCAACGGCCAAGAACCTGCTGCTCTTTCTGCGGTACCG
CGATGAGATGGAGGAGCCAGACGCGACGGCACCGACAACAGATGCAGACCGAAGGCGCACAGAAGACCGCAAGACGTACA
GCCTAGCCATTTCGTACATCACGCAGGCTGATGCGCCGCCGCCGGTGCGGTCGGAGGGTTTGAGCCTGCTGCAGGGCCTC
ATCACGGCAAACAGCGCGGTGCTGGATGTGGCGGCACTGCTGGTGCTGTTGTCGTCGCTGCTAGACGAGAGCGAGGACTA
TGTGAACCTGCGGGTGGTGCGGATGTTTGCGCAGGTGGCCGATCGCCATCCACGAGCGACGACGCGGGAGCTGCTGGACC
ACTATGTTGATGCGGGCGAGACGCGGCGGGTGGACACGCGGCTGCGTTTTGGCGAGGCACTGCTGCAGGTCATCCAGCGT
CTGGGCGAGACGTTTGCCGGCGAGACGGCCCAGCAGGTCGGCCAGACGCTGCTGGAAACGGCTGGCCGACGGGGCCGACG
ACCGAAGACGGCGGCGAAGCAGGCGCGAGAAGAACGACAGCGAGAGATGAGGGGGCGAAAGGTCGAAGCAGACGAAGAAG
GATCGGACGAAGACGAGAACGAGAGGGAAAATGAAAACGACAGAAAAACAAACGAGATTCTCAGCCGCATCGTCGACGGC
TGGGGCAGTCGGCGTGGCAGCGAGGACGTGCGGATCCGAGCGTCGGCCCTGTCGATCTTGGCGACGGCCGTCGAGACCAA
CGTGGCCGGTCTGGGTGCCTCGTTGACGTCGGCCGCTGTAGATCTCTGCCTGCACGTTCTCGCCATCGAGCCCGAGCCGG
AAAAGGCGATCCTGCGGCGTGCTGCCATCGTGTTGGTCCTCAGCTTCGTGCGCGCACTGCATGACGCCCGCGAGGCTCAT
CGTCGTCTCGGCTTCGGCCTCACCCAGGCCAGCCAGGACGACATCCTGCGCATCCTTCGCTACGTCGCCGCTACCGACGA
GGATGGACTCGTTCGCCAGCACGCCGCCGACGTCATCGAGAGCCTGCAGAACTGGCAGCTCGGGTCGCTGGTGCCGATGG
CCGGAGACGACGGAGCAGGACCTGGTCTCGGCAGGCTGGCCGGCCTTTCCCTCCATCCATCGCTGGACACAGGCAGAAGC
ACAGACGACAGCACGGGCACAGAAGCCTTGCGGAAGAGGCCCCGGATCGAAGAGGTCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62