GenePrediction:GLEAN_2195 Details

Name: GLEAN_2195
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1323593..1325015 (+ strand)
Length: 1423
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1323593..1324241 (+ strand)
Length: 649
Type: CDS
Source: GLEAN
Position: GCSC_108:1324320..1324409 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_108:1324478..1324570 (+ strand)
Length: 93
Type: CDS
Source: GLEAN
Position: GCSC_108:1324855..1325015 (+ strand)
Length: 161
>GLEAN_2195 class=GenePrediction position=GCSC_108:1323593..1325015 (+ strand)
ATGCGTCCGCTACTGAGATTGCGATCTGGTCTAGGCCTGGGGCTTGGTCCCGTTGTCGGTCTTGCTCTGCCTCGTACTGG
CAAACGCTGCATCGCCTCTAGCGGCATTGCCGTCCCACCAGTCGACAGGAACGGCCAAACGACGGCGACGAAGACGACGC
CACCAGTGCCGCTCTACCCAGTGCCGCGGCGCCCTGTATCGTTTGCTGGCCGCTCTGCTATTGTCACAGGAGGCAGCCGT
GGTATCGGCTGGGCCATTGCCTGCCGGCTCGCACTCGAGGGCGTCTCTTGCACGTTGGTTGGCCGCGATGAGGCTGCGCT
GCAGCGGGCGGTCGAGGCGCTGCCCCGGCCGGCGCCAGGCCCATCGATTGGCATAGGCAGCATTCCTTCCGTTCCAGGCG
TCACCGCCGGCTCCGATGTCAAACACTGGCACATGGCCGGCGATGTGCGTGAGAGCAGCCTCTGGGGCGCGCTGTTTGCC
AATACAGCCGACGTGCATTTTCTCGTCAACGCGGCCGGCGTATCTCAGAGCACGCTGCTAGCTCGCATGAGCCCGGCCGA
CATCCGCGATGTGCTCGACGTCAATCTTTACGGTACCATCTCGGGCTGCCGCTCGGCCATGCGCGCCTGGCTCAAGAAGC
GCAGCAAAGGTCTGTTGGACTTCTTCTCAATGTCTGTATGGGTCTGCTCGGGTCTGCTCGCTCGCTAACTTTTTACCCGC
CTTCCAGACCGCTGCATCCTCAACATTGCCAGTCTGCTTGCCGTTCGCGGCGGCTATGGCGCCACCGTCTACGCTGCATC
CAAGGCTGGCGTCGTTGGTGAGAACAGTCTTCTCCTTTTTCAAAGGTCTGCCCCTTCACCAGACAATCATCTAACGCAGC
CTCAGGCCTCACCAGAGCCCTGGCAGAAGAAGGTGCTGGACGGCGCATCCGTGCCAACGTCATCCTCCCCGGCTATATCA
ACACGGACATGATTGCAAGTGAGTTTATTATTTTTTGTGTTTATTCAGTTGATGCTCTCCGGCCAAGCACGCGGCGGCTT
CCTGGTTCATCCTCCTGCCCTGTTGTCATACATGTCCGCAGCTATCCTCCTGTTGCCTCTTTGTGTGCTGGCTGGTATCC
TCCGATGGCAATCCCCGTCCTTTCGACCAATATGCGTACAGCTCATGAGAAGAGGGGAAAGAACGCAGTGAAAAGGGGGA
AATCGGAAAAAGGGGAAAAATTACAGGCTGACGGTATATTGCACAACGTGCTCCCCTCCTAGACATGTCCGAACGCCAAG
TTGCAGATATGAAAACCCGCATCCCGATGGGCCGCTTCGGCACGCCCGATGAGGTGGCCGATGCTGCCATCTTCCTGGCC
AAAAACAGCTACGCCAATAACTGCGTGTTGAACCTGGACGGCGGCCTGAGTGCCGCATCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62