GenePrediction:GLEAN_2196 Details

Name: GLEAN_2196
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1327805..1328969 (+ strand)
Length: 1165
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1327805..1328732 (+ strand)
Length: 928
Type: CDS
Source: GLEAN
Position: GCSC_108:1328797..1328969 (+ strand)
Length: 173
>GLEAN_2196 class=GenePrediction position=GCSC_108:1327805..1328969 (+ strand)
ATGTCGGACGACGAGGCAGACCCGGAGCTGTTGGCGCTGCTGCGGCAGCATCTGATGGGCCGACCGGCCGTGGACGAGGA
CGCCGAGACGGGCGTGCTGGAGGGGGCTGAGTACGTGTGCGACAACGCGATCGACGTGGCCCTGGACATGCGGTCGTGCA
AGGACGCAGCCGAGACGATTTACGGCCGGATGCAGCGTCAGGCCTACTCGACGGCCACCTGGGCCGAGCACGAGCTGCAC
CCGACGGCACGCGACGCGTCGACGGTCGCCTTCATCTTCACCATGGACCTGCTCAACTTCTCCTTCTGGTCCGAGCGGCC
GGCGGCCGACCGCTTCGGCATCGAGTACCGCGGCAAGACCTGGACCGGCTACTGGAGCCTGGTGGCCGCCCTGCAGCGAG
CACTCGACGAGGGTGTGCCGATCACGAGCTCCGACTTCTGGCAGAGCGAGGACGAGTGTGATATGGCCCTCATGCGTCGC
GTCTTCCGCTCTGCCACGGACGAGGAGATGCCCCTGCTGGCCGAACGGCTCGACTGTCTGCGTCAAGCTGGCCGCGTGCT
CTACCAAAAGTATGGCTGCTGCTTCACAAACGTCCTCGCCGCGGCCGACGGCTCGGCTGCCCGCCTCGTCAACATCCTCG
CCCGCGACTTCGCCTGCTTCCGCGACGAGTTCCCCTATCCTGGCCGTCGTCGCCCCATCCGCTTCCTTAAGCGCGCACAG
ATCCTCGTCGCTGAGCTCTGGGCCTGCTTCCAGGGCACCGGCTACGGCGCCTTCCACGACATTGACAAACTCACCATGTT
TGCCGACTACCGCGTGCCGCAAATCCTGCACAGCCTCGGCTGCCTCTACTACAGCCCGCCGCTGCTCACGATTATCCGGC
AGCAGAAGCCGCTTGCCAGCGGCAGCGATCTCGAGATGCAGCTACGAGGTCAGTGGGGACTTGCAAAGAAAGAAGAAAAG
AAAAGAGTACAGGAATCCAGCTAACCGTCCAGCCTGCACTATCTGGTGTGTCGAGCTGATCCGCAGGGAGATCGTGCGCA
ACCACCCCGACGCCAAGATCAACGCCGTCCTCATCGACTTCTTTCTCTATGACACAATGAAGGAGCTCGAGGCCGCCAGC
AAAGACGAGGTCCCGCATCACAGGACCCGCAGCATCTGGTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62