GenePrediction:GLEAN_2197 Details

Name: GLEAN_2197
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1330516..1331244 (+ strand)
Length: 729
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1330516..1330567 (+ strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_108:1330623..1330682 (+ strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_108:1330748..1331244 (+ strand)
Length: 497
>GLEAN_2197 class=GenePrediction position=GCSC_108:1330516..1331244 (+ strand)
ATGGCGCCCCCTTCCGATCGCCGTCCCATTGTCATCTCCGGCCCCTCGGGCGGTACGTCTTGCTTCCACCGCGCCATGGA
CTCTTTGAGACTAATGCTTCTCTGCAGTCGGTAAGGGCACTCTCTACAACCGCCTGTTTGAACGCCACCCGGACGCTTTC
TGCCTGTGTACGTTGAAACCTCTTCCCAGCTCCTCTTGGCCTGCGTCCCATAGCTGACTTGGATGTGAACAGCCGTGTCC
CACACGACCCGCAAGCCCCGCCCCGGCGAAAAGGACGGCGTCGACTACCACTACGTCACCATGGAAGAGTTCGAGAAGCT
CATCGGCCAGGACGCCTTTGTCGAGCATGCCAAGTTCGGCGGCAACCGCTACGGCACCAGCAAAAAGACCGTCGCCGACC
AGACCGCCAAGGGCCGTGTCGTTCTGCTGGACATTGAGATGGAAGGTGTGAAGCAGATCCAGGACCAAAAAAAGAAGGGC
AACGGCTGGGAAGCACGCTACATCTTCATCGCCCCGCCCTCCACAGCCACGCTTGAGAAGCGTCTGCGCGGCCGCGGCAC
CGAGACCGAGGCCAACGTGAAGAAGCGGCTCGACCAGGCAAAGCTTGAGCTCGACTACTCCAAAACGCCTGGCGTGCACG
ACAAGATCATCATCAACGACGATCTTGACAAGGCTTACAAGGAGCTCGAGGACTACATCTTCCAGCAGCCAGCAAAATCG
AAGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62