GenePrediction:GLEAN_2198 Details

Name: GLEAN_2198
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1337833..1339771 (+ strand)
Length: 1939
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1337833..1337950 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_108:1338040..1338256 (+ strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_108:1338333..1339648 (+ strand)
Length: 1316
Type: CDS
Source: GLEAN
Position: GCSC_108:1339698..1339771 (+ strand)
Length: 74
>GLEAN_2198 class=GenePrediction position=GCSC_108:1337833..1339771 (+ strand)
ATGACTGCGCTTCAGAATGGCGCTGCGCCCAGCGCCCGGCTCCTGGCGCCCACGATCGTGGAACCAGACGCACGACCAAA
CGACGTGGTGGACGCCGGGCTCAAGAGCCTAGACCACTGTATGTCTCTCCCTGGCGTCCCTATGTCTTCTGGCACTCGTG
CGCTGCATCTCTTGTCCGGCTAACAATGCCGCCTCGCTCTCCTCCAGACAAGCGCGCCCTGCCCCGATGGCGGTACCGAC
TGCGCCAGCACTTGCTGCCCTTGATTCGCTGGGAGACGCCGTACCTCGCATATTTCCAATCCGCGATGCGCTCGCCTGCA
CTCGACAACTACTTCGCCATCACTGCCAACCTGGGCACACATACATTTTTCATGATCGGTCTCCCCATGCTCTACTGGTT
TGGCTATCCGGCCATTGGGAAAGCGTATGTTTGTTGCCACAGGAATGAAGGGGGTGGGTGACACTTTGCAAACGATTGGG
GCTAATGTTCTCCTCCATAGTCTGGTCCATGTCCTTGCTACGGGCGTCTTCTTCAGTGGCTTCTTCAAGGACATGTGCTC
GCTTCCACGCCCACTCTCACCTCCTCTGCAGCGCATCACCATGTCGGACTCTGTCGTCCTCGAATACGGCTTCCCGTCGA
CCCATTCTACGAACGCCGTGTCGGTCGCCGTTTATGCCATCCTGGCCCTACAAGATTCGGACTATTCGCCATCGACTAAG
TTGATGTCCGCCTTTTTAGGCTACTTCTACGCCGCCTCCATCGTCATCGGCCGCCTCTACTGTGGGATGCACGGCTTTGT
CGATGTCATCTTTGGCAGCTTTTTAGGTTCCTGTCTCGGCTACATCGAGTACTACTGGGGTCCGGCCCTGGCCGATTACA
TGCAGCAGAGTTCCTGGAAGGCCCCGGCACTGGCCACTCTCTTTATCATCGCCCTTGTGCGTGTCCATCCGGAACCGGCA
GACGACTGTCCGTGCTTTGACGACTCTGTAGCTTTTGCAGGTGTCATGATCGGCCTTGAGGTTGGCACATGGCGGTATCC
GCGCCTGCGCGAGTCCCTGGGCCTGGCGTCTGACAGTATCCCGACTTTAAGCCCGATTGTCGCCCTGGCACGTATCATCT
TTGGTGTATTGGTCGTCTTTGCCTGGCGCGAACTCATGAAGCCCACGATGCTCAAGACGCTCCCTCACCTTTTCCGTGTC
CTCGAGGTGATCGGCTTCAACCTGCCGCGACGCTTCTTCATGAAGGCGAGCGAGTATGGGAAAATTCCCGAGGTCTTGCG
ACTGCATACCGACAACGTCCTTCCGAGCGTCAGCGACATCCCCATAATGGTTCGCAACCTTCAGAACGCCCGGCGTGGCC
GCTCCGTCAGTATTGGTCCGCAAAGCGCTGCCGACGCCTACGAGACGCTGGCGTACCGGGAACAGCGGCGGCGCGAGAGC
ATAAGCAGTCAGACCAGTCTGAAGAGCCGAGGCAGCTTCCTCGACCTGCACGAACAAACGGCGCCAGCAGCGCCCGAGAA
CATGGCCGTCAGCACTGGCAACAGCGCCAGCGACCGAGACGGAAAGGCAACAATGCGAACGACGGGCGTTCGCAGGCCCT
CGCTTGTCCACAGGCCCTCGCTGGTCCAGTTCGAGGAGATGATGGGCCAAGGAACCGTCGTGGAGTCGACGGCGTTCCCG
AGCTTGAGCTTTGAAGAACCAGAGCTGTACGTCGGCCGACAAGACGAGTTGGGCGAGAAGGAGATGTTTGAGAAGCTGGT
GAAGCCACGTGTCCGCTACGACGTGGAGGTCGTCACCAAGCTGGTAGTATACACCGGTGAGTCTTTTCAGTTATCCCATA
TGTGATCGTGAGACTGACTGGTCAGGCATCGGATGGCTGGCCGTCGAGGCCATTCCTATGATGTTTCAGTTTATCGGCTT
GGGTGCACCGTATGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62