GenePrediction:GLEAN_2199 Details

Name: GLEAN_2199
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1345002..1350304 (+ strand)
Length: 5303
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1345002..1345493 (+ strand)
Length: 492
Type: CDS
Source: GLEAN
Position: GCSC_108:1345602..1348525 (+ strand)
Length: 2924
Type: CDS
Source: GLEAN
Position: GCSC_108:1348736..1349122 (+ strand)
Length: 387
Type: CDS
Source: GLEAN
Position: GCSC_108:1349187..1350134 (+ strand)
Length: 948
Type: CDS
Source: GLEAN
Position: GCSC_108:1350202..1350304 (+ strand)
Length: 103
>GLEAN_2199 class=GenePrediction position=GCSC_108:1345002..1350304 (+ strand)
ATGGCCACAACAGCTTCAACCAGACCTGTTGTTGCTGATACCGCGGCTGTGGACTCCGCCGAAGCCGCGGCGACTGCACC
CGACGAGACCATCGGCCTTCACTCGCCCCCCGACAGTAACAACGCCTCCAAAACAGACGGCTGCAGCAGCTCCGACTCGG
AGCTCAGCTGTTTCGACGATGACTTGGCCGAGGCTTTGAGCAATCCGCCCGCTGCCGAAATCGGCTCACTTGCGACCGCA
CCGGCTGCTGATACTGGTGCTCAGGCTGAAGCTCATGTTCATGCTCATGCCGAGGCCGATATTGTGCACGCACACGTCGA
CGACACAGCCGCAGCCTCGCCTGCTCTTCCGTCTACAAACGCCTCCCCCGGCAATGCGGCTGAGGACGACGATATTGGGG
ACATCGAGCCGGACGAATATTCCGGCACTGTTCCGATCTTCCGTCCAACCATGCACCAGTTCCGAGATTTTAAGAAATTT
GTGCGCTTTACCGTCCTCCATTGCATTGCATTGCCTCTTCCTCCTTTGCCCTCCGCTCTCCTTATCACCCTACTCTCCGG
TGGAACTCATCTAACTAGGCCCCCCCTTTTCCCCGATTAGATGGAAAAAATCGATCACTATGGTATGAAGTCCGGTATCG
TAAAGATTGTCCCACCCCAGGATTGGTCCGACACCGTCGGGCCTGTCGACGAGCTGGTCAAGGGTATCAAAGTTCGCGAG
CCCATCAAGCAAGACATTATGGGCTCCAACGGGACCTACCGTCAAGTCAACATCCTTCACCAGCGGACGTACAATCTGCC
ACAATGGCGTCAGCTCTGTGACCAGAGCGAGCACCAGCCTCCCGCCCGACGTGGCGAGCGTCGTGCCAACGCGGACAAGC
CCAAGCCGACTACTCGCACCCGTTCTGCTGCGGCTGCGTCTTCGGCGACAGTTAATACGGCGGCTGGTTCCGTCCCTGCC
GCCCCCAAGAAGGGCAAGCGTGGTCGGACTACGCGGAGATGGACGACGCGCCAGGGCGTTGATGATGACGCCTCGTCGGT
CTTGTCTGAGCCGCGCCCGATGACGCCCGAATCCCAACGAGGTGACGATGATAGGCTCCAGGACGATGACAAGACGTGCG
TGGAAACTCCCGAGGATACTGGTATTGCCCACGAAGATAGGGATGACAAACCCGAGGACACGGTCATGGTATCCGTGGAG
GTGGACCACCTGGTAAAGAAGGAAAGCAGCGGCGATGCGGGCGATGCCGAGGACAGCTGCGTCGAAGTGCCGGCACCGCC
TCGCCGCCTGGGCTTCACGCGCCAGGCGTCGGCCAAGACCCAATCGACGTCGGCTCGTCGCAAGTTTGGCAAGCGAGAGG
GGTCTGCCAAGATCGACGAGGCCTTGTTCAAGGACTGGGACTACCGGATGGATGCCTCCGACTACACCCCGGAACGCTGC
GAGGAGCTGGAGCGGATCTACTGGAAGACACTGACGTATGCCCCTCCGCTGTACGGGGCCGACCTTCCCGGCACGCTCTT
TGACGAGAACACGGAGCTGTGGAACCTGAACAAGCTGCCCAACCTGCTGGATGTGCTGGGTACTAAGGTTCCCGGAGTCA
ACACGGCCTACCTCTACCTGGGCATGTGGAAGGCCACGTTTGCGTGGCACCTCGAGGATGTCGACCTGTACAGCATCAAC
TACCTTCACTTTGGGGCGCCCAAGCAGTGGTACAGCATTTCTCAGGGCGACGCCCGGCGGTTTGAGGCAGCCATGAAGAA
CATCTGGCCGGCGGACGCCAAGGCCTGTGACCAGTTCCTGCGCCACAAGGCCTTTCTCATCTCGCCGTCCCACCTCCAGC
AGCACTACAACATCAGGGTCAACAAGTGTGTGTCCTACCCCGGCGAGTTTGTCGTCACCTATCCGTACGGGTACCATTCC
GGATACAATCTCGGCTACAACTGCGCCGAGGCAGTCAACTTCGCCCTGGAATCGTGGCTTCCCATGGGAAAGATTGCCAA
GAAGTGCGAGTGCGCCCAGGCACAGGACAGCGTCTGGGTGGACGTGTACGAAATCGAGCGCAAGCTGCGTGGCATCTCCA
CGGACGACGAGGATGATGAGGACGAAGACTCGGATGACGACATGGACATGGACGACGTGGACGACTTGGACGATCAGGAG
GGCTCCATCATCGGGCTACCGACGCCGCCGTCAGGACGTGTTCGTATCCGGGCGCCGAATCGAAAGCGCAAACGCGGGGC
GGACACGGACAAGGGCGACACCGCGGACGAAGCGGATGGCCTGAGTCGTGCTGGTGCGCGGAAGCTGAAGCGGATGCGGC
TGCGGCTGCAGTCCGCCGAGGGATCCCCTTGCTGCCTCTGCCCAAACGACATTCCGTACGCGGAGCTTTTGCCGACGGAC
GACGGGCGCAAGGCCCACCGGCTTTGTGCGCTGTATTTGCCGGAGACGTGCATCGACGTGATCGATGGCAAGGACGTGGT
GACCAACGTGGCCGAATTCACAGCGGCGCGGCTGGAGGTGCGATGCATGTACTGCCGGATGCGCAAGGGTGTGTGCTTCC
AGTGCTCGTACACACGATGCACGCGGTCGTACCACCCGACGTGTGCGGCAGCGGCAGGCGTGTTTGTGGAGGAGGGCGAG
GTGCCCGTGTTTGGCGACGACGGGACGGAATACAAGGAGCAGGCGTTTGAGTTCACGTGCCGGTTCCAGCGGGCGAAGCG
GGACAAGAAGTACGACGGTGAGGCGCTCGAGAAGAACGAGCGGATCCGCAAAGCGGCGTCGGCCCTCAAGAAGGGCAGCA
TATGCCAGATGCAGTTTTACCGCAGCGACATTTTTGCGGGGGTGGTGCTGGAGAACCGGGCGGACGAGGAGACGGTGCTG
CTGCATGTGGTTCCGAGCGGCGACAGGGTGGAGGTGGAGTGGAAGTGGCTGCTTCTGCCGGATGCCAGCGACTATCGGCT
GCCCAAGGCCTCGCCCCACGCGCTGCCGCTGCCGTCGTCGCGCAAGGAGAAGGAGGAGATTGGGGCGAAGAAGCGACCGG
TTCCGGTGCCGGACGACGTCTTCGTCGACGGCTTTCGGTGGAAGGAGTTCCACGCGTGCGAGGCATTTGCATGTCGCAAT
CCCGACCAGGTCCGTGTCGATTTATTCAGGCCGGACCGGCTGTGGCACTACATCGGCAGGCCGTCGACGGATACGAAACC
GCAGTACACGGAGGATCCGGCCCATCCGACGCACAACCTCAAGAGCAACTTCCTCGACTCGGTACCCAAGCCGCCGGTGC
TCTCGATGCAGCCTCCTCGACGACCCTCTCTTCCGCCAGCACCCATGTCTTTGATGTCGCAGACGGCACAGACGGCTGGG
CTGTCTCCCTTTGGCAGCACGGTCCTGCAAGCACAAGCACAGATTCCTGCGGGCCAGACGGCCGTTGCGTCGCCATCGGA
GCCCCGGCGGTCGTATAGCGTGATCAAGCCGCCATATGTACCGCACACACTTCCAACGACGGCCGCGGCTGGACAGCCGT
CTTCGTCCGTGCTCACACCGCAAATCGTGCCAGCAACAGCATCGATAGCATCACCTGTACTACTAAAATCAACAACCTCG
TCTCTGGTAGCGTCATCAGCATCGGCATCCACGTCCACATCCATATCAACATCAACAACACCCGCCGCTTCGGCAGCAAC
ACCAGCTGCACCTGCAGTTGCAGCAGACAAGCCTCCGAGTTTCCGGCCGCGCAGGCCGTCCGACAATTTTCCCACGCCAC
GACGGCCGTCAACCAAGCATCAGCACGGCGGGATCCAGCGCCATCGGTCGTACTCGTCGGGCCACCCTGCTCCTTTTGGC
TCCTTCTTCTCGCTGCCAGCGGGTGGAAATGGCAGCAAGTTTCCTCAGATTCAACATCCGAACTTGTCTCATGGATATGC
CACGATCCCGGGGAAGCCATCAGGATCGGGATCGGGTGCGCCAAATACTTCCATGTCCCCGCCACCTGCACCGCGGCCAT
CGGCAAGCCAGGCGGCCGAAGTCGGCGCAGAGACACGAGGTCCTTCGGCCAGCGGCGAAGCTGCTCCTCTATCGACAAGC
ATCGCGCGGAAATATGCTTTTTTCCAAGTGCACTGCAACAGGTATGCATCCTGCCTTTGACACGTGTATGCTTGCAAGTT
CAGCCCCTGACTCTTTACTCTGCAGGGATCCAACCGGCTATCGGTCTCCGTATGAGCCGTGGAACAGTTCGACCAAGGCC
CCCGAAAGCACGACACGGCCGCGATCGAAGAGCAGGCAGGGCAGCTCGGGCGCCGCAGCACTTGCGGCAGCAGCCAACAA
GTTGCACCGGCGAGGTGCCAGCAGCACCAGCAGCGCCAGCAGCTTTGGGTTCGGGCTTGGGTTGAAGGGGCTGACGCGGC
CGTCTCCCCACACTAACTATGTTGGTCCGGCGCCGGCGCCGTCATCGACCGTGTCGTCGCCCTACCTGTCTGCACACAAC
CTGCCGTTTGGACCGGGACCGGGATCGTCTGTATCGTCGTATGCGTCGTACGATTCGGTCATGACTGGCGGAGCGCGCAT
GTCGCCACACTCGCCCGGGCCAGTCGATGCGAGTCCGTTTGTCGGCAGTCCCGGCCCACAGATCAGCGCGTTTGACTTCC
CGCCCGTGTCGGCGTCGTCATATCACCATCCCGGCATGCGGCCGCAGTTCAACAACTCGTCGTGGCAGCAGAGCTTCCAC
TCGCCACTCTTCTCGCAAGGTGAGCTATTCCGGGATGACTACCTGGAGGAGAGCATGCAAGCTGACGGCGATCCCGTCCT
GCCAGACATGAACGAGGTCAACTTCTCACCGCCGTCTCCCATCGCGTCGGCCACTAGCTTGCCGGGCCTCGGAGCACCGG
CGAACATCATCCCGAGCCACCACCAGTCGTATTCGTTTAGCGGCAGGACGATGGCCGATGGCAGTCCGCTGCTGTCGGCC
AGTATGGGCGGCTACGGAGCCATGAGCCCGCCGTTCCTGGAGGAGTCTCCGCTGGCGATGAGTCCGTCGATGGAGGAAGA
GGCTGTGCCACCGGACGGAGGCACCCAGCAGTCGCCTGCCGAACAGCTCAGACAGCAGTTGCGGAGCATTTCCGACTCCT
CGCTCCCGTCAACGTACGTGACTGACCGGTCGTGTTCATTGTGTTTTTTGGACGAAGCGATGTGCTGACTTTTTCTGCAG
ATACCGCCTACGATGTCTACACCAGCCTCGACGGCGCCATCAGAGCCGCAGCAGCCTGAACCGGATATTCACGAGCCAGC
TCCTGGACCTGAACCCGACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62