GenePrediction:GLEAN_2200 Details

Name: GLEAN_2200
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1362951..1364821 (+ strand)
Length: 1871
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1362951..1363120 (+ strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_108:1363186..1363220 (+ strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_108:1363271..1364026 (+ strand)
Length: 756
Type: CDS
Source: GLEAN
Position: GCSC_108:1364091..1364215 (+ strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_108:1364274..1364435 (+ strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_108:1364489..1364821 (+ strand)
Length: 333
>GLEAN_2200 class=GenePrediction position=GCSC_108:1362951..1364821 (+ strand)
ATGACTGGCCACATCCTGGCCTCTGAGCCTGACCTGAAGACGGCGCCCTTTACGTCCTTTACGGTGGCTGAGGACGCAGC
GGACGTCGACAACAAGGGCGGCATTGTGGCCCCCGACCAGGAGGACGAGAAATACCGCACCACCAAGCAGGAGATCTGGG
CATATTATGGGTGCGTCGTCGGCCGGACCACGGAGAAAGCTACAGGGCCATGGCTGGGGCTGACCGTTAGGACAGCTACT
ATGTTGGGAACAACGGCCTAAGTCTCTTCAGTAGGTGATCCCTCCCTCTAGAACAAGACAGCACTCTGACGTGCCACCAG
ACTTTGCCCCATCGGCCTTCCAGAACCTGCTCTACCAGGCGGCCGGCGACGGCAACACGCTGCGGTTTGCCGGCCAGCAG
CGCACGGTCGAGAGCATCGTGCTGCTGTGCAACGGCATCTCCTTTGCCATTCAGATTGCCGTCTTCCTCGTCCTCGGCAG
CTTTGCCGACTTTGGCCAGTGGCGGCCCAATATCCTGATCGTGCTGTCAATCATGGCCTATGCCATCGGCTTCGCCTGGC
TCGGCGTCCATACTGAGGACAAGTGGCGCATCGGCACGGGTCTCTACATCGTCGGCCTGATCGCCTACCAGACCACCTTG
ACCTTCTGGACGGCCGCCTTTCCCGCCCTCGCTCGCAACACGGACGAAATGCGCACGCACGCCGACAGCCTCGTCGCTGG
TCGCATCTCGCGTGCGGACTACGACTATGCCGACTCTATGAAGCGTAGCCAGCTGGCCAACGTGTCGTTTTACGTCCAGT
CTGTCGCCGAGATCGTTATTCTCGCCCTCATCGTCGGCATCATGTTCGGCCTCCACGTCAACGCCAGCACCGCCAACAAC
AACTGGGGCATGAGCGTGCTGATCGCCTTTGCCACCAGCGTCTGGCTGCTCGTCTCCCTGCCCTGGTTCTTCCTCGAAAA
GCGCCGGCCCGGTCAGGACCCTGGCCGCCGCAACATTGTCCTCGCCGGCCTCTCCCAGCTCGTCTACGCCCTGCGCCAGA
TTTGGAAGCTTAAGCAGAGCCTGCTCTACCTCGTCGGTCAGCTTCATGCAAACGGGGTAGCTTCCTCTAACAGAAATATA
CAATAGCTGACCAAGCACAGGTTACTTCTTGCTCGGGGACTCTCTCAACACCAGCGTCACTGTCATCTCTACGCTACAAA
ACAGCATCGTGTCGTACAACACACTGCAGTTAACGTACCTCCTAATCGTCGGGATTGTTGCTCAGGTACGCCGATTTGTT
GCAGTGTCGGGAAGTACATCCGCATTGTCTAACTCGTTCTCAGGCCGTTGGTATCTGGGCGTTCTGGACTGTCCAGAAAC
GATATAAGATCGGCACTAAAGCCATGTTCAACTTTGTCGCATTTTGCATCATCCTGCTAGACGGCTGGGGCATGATCGGT
ATATGGACCAACAAATTTGGCTTCCACCACCTGTGGGAGATCTGGGTGAGTTCCCATTGTGACTGAGTTGGAACAGGATT
TGGCCTGACTCATCCTAGGTATACCAAGCCTTCTACGGCTTCTTTATATGCCCGTGGTACAGCTACTCGCAGATCATGAT
CTCTGAAGTCACTCCACGTGGCCACGAGTTTCTCTTCTTCAGCCTATTCAGCATCATCGGCAAGACATCTTCGTTCATAG
GCCCTATTGTCTCGAGCGCTATTATTGACGCGTCGCCAACTAACAACTCGTCAACGCCCTTCTATTTCCTGTTCGCACTG
ACTGTAGTGAGCTTGGGGATTCTGGTTGTTGGCGTGGACCTGAAGAAGAGCCGGGTGGAGCAGCGGGAGTTTCTGGATAA
GCGCTTACGCGGTATCAAAGCCGACATTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62