GenePrediction:GLEAN_2201 Details

Name: GLEAN_2201
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1366987..1369331 (+ strand)
Length: 2345
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1366987..1367007 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_108:1368696..1369331 (+ strand)
Length: 636
>GLEAN_2201 class=GenePrediction position=GCSC_108:1366987..1369331 (+ strand)
ATGATGATCGGCCATTTGGCGGTAAGCTCGGCGCACAATCGTTCTTGAATATAATTCAGTTTCACAGGACTCAGAACCTC
AGCCAAATTGGCGCGTTTTGGGCTGCACTGTCAGCCGTTGAAGGATCAGCTAACGAACCTGATGCTGGGTCTTCCAATAC
AACGGTGAGTCCACCCAGGATGCGGTCGGTGACGGCGAGGCAGATTGCCTTGGTCAGGTCACAGGCCCGCACAGAATCCC
TGCGTCCGCTAATACGTCCGGGCAGTCGCATGCGTCAGATTTCAGCTACGTGGACAGCGGTGAGCACCACCGTGATGTTG
CAATACCGGAGGATGCCACCGTGCAACTGGCATCGGCCTTTATCGGCCATGTACTGGTTAATTTCCCGTGCCAGCAGTTT
TCCCGAGAGGATGGCAGTCTGTGCGACGACATGGCAGTCGTGGTAGAGTTTACCATGTACGTACGGAGCGGGTTGTCGAC
CTCGCCAATTGCCAGAAAGTTCGTGCTACCGGAGACGGCGAGTTCTTTGCACGAATAATACTGCATCTGGCTACAAATTC
TGCGTCGAAATGCCAGTGGTCCTGCTTGAAGCAAAACGTCAGGAATCACGAATTGATGATGGAGTCGCAAATGTCAGCGA
GAACCTGCTCGGGCAGATGAAGGCCATTGCCGTCCGTCAGCAGGCCCAACATCCCGAGGTATACATCATATATGCGGTCA
GAAAAAAAAGTCCGTTTGTCTACAGCTTTGTCTTCCGAGAAGGTGTGCTGACCTTGCATAATAGGCAGGACAAGAGCGCA
GCCGCGCTAGAAAACAAAGCCCACCGCTTGCAAAAGCAGTGATAATAGCAGAAGCAGGAGCAGAAGCAGGAGATGCTACT
GCAGCCGCAGCAGGAGGGTGGGAGGGCAGGGTGGCTTGGATCGGTCCAAGCGTCGAGCTTAAGAAGATGGAGCTGCGGCA
GCGCCTTTTTCAGGCAAATAACAACGGTGGCATGATTATCTACACACCACGTCTGTAGAACTAAATTGGTTATACATATC
CCTGCCTACTTCGCTGTAAGGTAGGTATCATAAGTACTTTTGCAGACAATTTGATACCAATCAAATTGACCAGAAGATAA
AGTTCAGGAAGCTGCGCCTGTTTCAACGGCCAAGGACTTCTGCACCGACCAGCGCTGGTTAATGTGCATAGTAGGGAAAG
TCTAATCAATGTACAGTAACGGATGTTTTAAATACAAGTGCTAAGTTTCACCTTGCTATGTAGCTTGAGGAAAAGCCCAT
AAGAGAAAGATGCTATTCGTCTCTTGCTCCAACAACTTTTTTGGGGGGTTAACCTTTGTACAAATTTGCAGAACTAGAAC
CTCTCGTAGCAACATCTATTGGCTGTCGATCAGGTTATCGGCGAAAAGTACCATGCAGTCCAGAAATTGAGACCTTAGGC
ATAGAAAGAAATGGCTGCCCCTCATTCGATAGAATCGAAGGAAAGGTTGCAGTGCCACCAACGACGCCGTTAGTCTGGGA
TGAAATTGGTGGTGATGGGCATCTGTCATGAGGAGGGGTAAACATCCCTCCTAACTGTTACATATAAAGAACGTAACCAT
AGGTCACAAACGGGTACATCCGCTCTTCATCTCTTCTCCGCACGATCCATCCTTGCATCCTATTTCTCTAAAGTTGAAAT
TTATACATATTGTCCGATAATCATGGCAGCTGCTAAAAAAGGCACAAATCACGAGCAAGAGGTCGAAGCGGCTATCACCT
CTTTTAAGGGAGACCCATCTCAACAAAGTGATCGAATCCGGTCTTGTCGACACGCTATCAACCGTCTCCGTCCTTGTGGA
CACACTCTATGCGCAGCCCACAACGCCTCCGTCACTCTACATTGATCTTGAGGGAGTTTATCTTTTCAGAGAAGGCACCG
TGTCTATTCTTCAGGTCTATGTGCTACCACTGGGCCGCGCATATCTCCTTGACGTCCATACTCTCAAAGACGCTGCCTTC
TTGACACCTGGGACTAACGGCCGCACCCTTAAGGACCTGCTGGAATCTAGTGCTATCCCCAAGGTGTTCTTTGACGTGCG
CAACGACTCGGATGCCCTATTCTTCCACTTCAAAATAAATCTTGCGGGTGTGCAGGACCTGCAGCTTATGGAACTTGCAT
CGCGTACACATTCTAGAAAGTATGTTGCTGGACTCGCAAAATGTATTGACAGGGATGGGAATTTGAGCCCGGCAAAAGGG
GCGAAATGGAAGGCGACCAAGGAGAAAGGCCTCAAGATGTTCATGCCGGAGTCTGGTGGCAGTTACGAAGTGGGTTCAAC
GAACGTCCCCTGTCGGAAGAGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62