GenePrediction:GLEAN_2202 Details

Name: GLEAN_2202
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1374194..1374520 (+ strand)
Length: 327
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1374194..1374520 (+ strand)
Length: 327
>GLEAN_2202 class=GenePrediction position=GCSC_108:1374194..1374520 (+ strand)
ATGAACGACAAACTCAACGTCTGGCTCGACAACAAGGAGCATAGTGTCGAAGGCCATACTATGGAATGCACTCTTAAATT
CAAAGGAAAAGTTATCTGGGGCCCCACTTCTTGCCACGACAACACGATTGCTCTGAGAGAAGCCATCCATGACGCGGATG
ACCGTTTTGACATGTCCTTTACTAAAAAGGATAAGACGGGTGAAGGCCACACACGCTATATCAGCGTCAAGTCGAACGAC
AAGGTTGTTCTGGACAAACTTTCTACTCACGACGACATGGCTGGGTTGGTCAATGCTATTAAAGTCACTCTGATTGTGGT
AGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62