GenePrediction:GLEAN_2207 Details

Name: GLEAN_2207
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1451789..1453025 (+ strand)
Length: 1237
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1451789..1451968 (+ strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_108:1452070..1452145 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_108:1452214..1453025 (+ strand)
Length: 812
>GLEAN_2207 class=GenePrediction position=GCSC_108:1451789..1453025 (+ strand)
ATGTCGGCCTCCGAATCGTCTTCACAGTCCGCATCCACCGGCGGTCCCAGGACAAGGAGACCGTGGGCACCGGCCGAGGA
CGCGGTGCTGCAGGCTCTCGTCAGCCATTACGGCGATGCCCGTGGATCTAGCGGAGCCTGGAAGGAGATATCAGCTGCTA
TCTCTAATCGCACCGCTAAGGTAAGGCTCCGTGATCAAACCGGGAAAGGGATGAAGTCTAAGTATCGACCCAGGACTGTC
GCAAACGCTGGTTTCACTCTCTCGATCCATCTCTCCGCAAGGGACGGTGGACGGCAGAAGAAGACCAGACTCTCCTCGCG
GCATATACTCGACTGGGACCAGTCTGGCATGATATTGGTGAGATCCTCCATCTTCCCTACTATTCCCTTGTCCTCTACTT
CGATACTTCTCTCTAACCACGACAGCTGCCCTGATCCCCGGTCGGAAAGATGACCAGTGCTCTAAGCGATACAACGAGAT
CCTCAATCCACTGGTTAGCAACCGGCTGACCGACTGGACCGCCCGGGAAGACGACCTTCTCCGCCAAGGCGTCCACGCCC
TCGGCCATCGCTGGTCCGCCATCTCATCACGGATCCCCGGCCGGCCGCCATTGACATGTCGCAACCGTTGGCGCACGCTC
TCCAGGTCGGCGTCAATGCGGCGGAGCCAGGAGCTGTTGGCCTCCATCCAGAGTCCCGCCGACCTGTGCCACGAGACCAG
CAGCGAGAAGCAGGCCTCTGCCGAATTCTCCAGTCTCTTTAGCGAGCTGGACGACCAACTGGCTGATCGAGAACACGACA
GCCACGGATTCATCGCCTCTGCTCTCTACGACACACCCTTCTCGGCTGGCACGGAGTCTCAGTCGGCCATTGACCTAACC
GACCACCAGCCCCTGCTCCTTGGTGGTATGGAGGCACAGACAAGCCCAGAACAGACCTCGTTTGCAGCGTCAAGGCCCGA
CTGGTCTGCCTGTTTGACCCGGCCTTCACACATGCATCATGGTAACCATTCGGCATGGATGGGGCCGCCACTACTCTCGC
CCGACTCTACGGCAGCCCTGCCAAATTTGCACGAAAACTTCAGTGCTGGACAACATACAAACTCGTCCAACCCAATACAC
CAGATAGTCCATGTACACCATCACTACCACTACCATATCGCAAAGCCAGATGCCTTTCTTCCATTTCTGCCCTCGGAGGC
AGAAGCACGGCGTGAAGAGCCCCCAAAGGAACCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62