GenePrediction:GLEAN_2208 Details

Name: GLEAN_2208
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1453470..1455106 (+ strand)
Length: 1637
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1453470..1453583 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_108:1453673..1453844 (+ strand)
Length: 172
Type: CDS
Source: GLEAN
Position: GCSC_108:1453901..1454005 (+ strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_108:1454065..1454134 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_108:1454191..1454924 (+ strand)
Length: 734
Type: CDS
Source: GLEAN
Position: GCSC_108:1455018..1455106 (+ strand)
Length: 89
>GLEAN_2208 class=GenePrediction position=GCSC_108:1453470..1455106 (+ strand)
ATGAAAGACGACACGACAAAAGTTAACACCCTGCAAAAGACGGTCTCTGCCACCGATGGCGAGGTTGAGGCCATTGGGAC
CGGCCTACAGCGAGGCCTTGCCAATCGCCATCTGGTATGTCTTCCCCCTCTCTCCCTCTCTATGCGTGATTGGTGCCATC
TCAGGACCCTATACTCTAACCGCATCTCTCCGTACTTCTATAGATGATGCTGGCCATTGGCGGAGTTATCGGTCCGGGCT
ACTTTGTTGGCATGGGCAATGGCCTCTCATCTGCCGGACCTGCAGGACTCCTCATTTGCTTCGGCATCGTCGGTACTCTG
CTATGGGCTGTGATGCAGTCCTTGGGCGAGCTGGGAGCCTTCATTCCGCTACCCGGTTGGTCTTGAGACGCAGAAGTCAT
GTGGACAGTTTAATCTAACACGCTCTATCAGGTTCATTTACACACTATACATCCATGTTGATCGATCCAGCACTAGGCTT
CGCTCTCGGCTGGAACTACTGGTTTCTCTGGGCTGGCATCATTATGGCTGAATACAGTAGGCTTCCTTCTCCCAACTCTT
GGCTTTGCACCCTGGTCATGCTGATCAAATGACAGACAATCTTGGCCTCGTGCTCACCTTTTGGGACACACCCATCCCCA
GATGGGGCTGGGTTCTGATTTTTTGGTTCGTTTGTCGATCAGCTCCGTCGTAAGAGTGTCAGCTGACTAATATGTGATCA
GGGGTTTCTTCCTCGCCTTTACTCTCCTGGGCGTCAAATCATTTGGCGAGGCCGAGTTCTGGCTGGCCCTAACTAAGATC
GTCGCTATCCTGGCCTTTTTTCTCTGTGCTATTCTCATCACGACTGGCGTCCTGGGCGGGCACAAGATCGGCTTCCGCTT
CTACCACGATCCAGGCCCCTTTGCTGATGGTGTCAAAGGCGTCTTCAAAATCTTTGTCTTTGCGGCCCTGCAGTACAGTG
GTACGGAGATGATTGGCCTGACGGCTGGAGAATCTTCGAATCCCGGCCGGGACGTTCCCAAGGCCGTCAAGAGCGTGTTG
TGGCGCATCGTCGGCATCTTTCTTTTCGGTATTTTCTTTCTCACCCTGACTGTTCCCTGCAATGACCCCGACCTGCTTTC
GGCCAGGAGCAAGACGGCCCGCTCGCCCTTTGTGATCGCCTTTACCCGGGTGGGTGCTGATGCCGGCGCCCACGTTGTTA
ATGCCGTTATCGTCGTCACCATGTTCTCGGCTATCAACAGCGCCCTCTACGTCGGATCGCGCACTCTCTACGGCCTCGCA
GCTGAGGGCCTAGCACCCAAGATCTTTGGCTGGTGCAACAGTCGTGGTGTTCCAGTGTATTCGCTCGTGTTTATGAACCT
CATTGGCTTCCTTTCGCTTCTCAACTTGTCCAGTGGTGCCGGACACTTGTATACCTGGATCGTCTCCATGACCGGTATTG
CCACGTTCATCACTTGTAAGTAGCTGCTGGTATCAACCTTCCTTCTTCCTATCTTGTTGCTGACCGCCAGGGGGTCTAAT
TTCTTTGTGCCACATCCGACTTCGCCAGGCATTGACGGCTCAGAACATCAGTCACTCTGTCCTCCCCTTTGGAGCTCCGG
CCTGGAAGTTCTGTGCTGGCTTTGGTCTTATCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62