GenePrediction:GLEAN_220 Details

Name: GLEAN_220
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:378683..379745 (+ strand)
Length: 1063
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:378683..378707 (+ strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_167:378796..378808 (+ strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_167:378919..379468 (+ strand)
Length: 550
Type: CDS
Source: GLEAN
Position: GCSC_167:379572..379745 (+ strand)
Length: 174
>GLEAN_220 class=GenePrediction position=GCSC_167:378683..379745 (+ strand)
ATGTTTATGGCAAGATCGGAATATGGTCAGCTTCTTGTTTCGTCCTTCTTTGCATCGCTCTCTGGCTGTCCTCCTTGCGC
ATTGCTCTCGCTGACTGACGATATCGCCGACAGATCGGGGTATCAAGTACGTGAACAGCTGGAGCCGCATCGACTTCGCA
TCGAACCCTGCATCCTGCATCCTGCATCCTACATCCTTTCTCCATTCCCCCCAACGCGCTGACCCAAAATCCACAGCACC
TTCTCCCCCGAAGGCCGGCTCTTCCAGGTCGAGTACTCGCTCGAGGCTATCAAGCTCGGAAGCACCGCCATCGGCGTCGC
CACCGCCGAGGGCGTCATCCTGGGCGTGGAGAAGCGCGTGACGTCGACGCTGATGGAGGTCAGCTCGGTCGAGAAGATTG
TCGAAATTGACCGCCACATTGGCTGCGCCATGAGCGGCCTGCAGGCCGACGCCCGCAGCATGGTCGAGCACGCCCGCGTC
GAGTGTCAGAGCCACGCGTTCAACTACGCCGAGCCGCTGAGCGTCGAGAGCTGCACCCAGGCCATCTGCGATCTCGCCCT
GCGCTTCGGCGAGTCCGCCGACGGCGAGGACAGCATCATGAGCCGCCCCTTCGGCGTCGCCCTGCTCATCGCTGGCTACG
ACTCCGACATTGGCCCCGACGGCAAGGAGGGCGGCCCCGCCCTCTATCACGCCGAACCCAGCGGCACCTTTTACCGCTAC
GACGCAAAAGCCATCGGCTCCGGCTCCGAGGGCGCCCAGGCCGAGCTGCAGAACGAGTATCACAAGGTCTGATAGTGTTT
CTGCCTCTGCCTAATCTTTCCCTTTCCCTTTCCCTTTTCCCTTTACCCTTCCCCTCCCTCTCCGCCTCTACCCCCGGCTG
ACCTTACAGTCTCTCACCCTCGCCGACGCCGAGACTCTCGTCCTCAAGACGCTCAAGCAGGTCATGGAGGAGAAGCTGGA
CGAGAAGAACGTTCAGCTGGCCAGTGTCACAAAAGAAAAAGGCTTCCGGTTATACACCGACGAAGAAATGGCCGCTGTCG
TCGCCCGGCTACCAGCAAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62