GenePrediction:GLEAN_2210 Details

Name: GLEAN_2210
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1467910..1469070 (+ strand)
Length: 1161
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1467910..1467925 (+ strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_108:1468100..1469070 (+ strand)
Length: 971
>GLEAN_2210 class=GenePrediction position=GCSC_108:1467910..1469070 (+ strand)
ATGTGCTGGGATTTAGGTAAAATAGTCTTTATCTCCCGCTGGACAGGACTGAAATAGAATACGTATAAGACAAGACCTAG
AGCCACGACCACGGCGAATGATCCCATCGACATGGTTTTATTAGTTTCATATCCTGCTTATTTGCCATACTTATTCCACC
CTCGGTTCGTATCTCGTTGTATTCTCACAGTGCGTGTCTTTGTCACTGGATCTACTGGCTTCATCGGCACGGCCGTTGTG
AAAGAACTTGTATCGGCCGGACACAGCGTCGTCGGTCTGACCCGCTCGGACAAGGGACAGGAACAGCTCAAAAGCCAGGG
AGCCAAACCTCTGCGTGGCGCCATTGAAGATCTGGAGCTGTTCAAGAAGACAGCCTTTGAGAGTGACGCCGTCATCCATC
TAGCCTTTATCCACGACTTGGCCAACTTTCTTAGCGCCTGCGAGACAGACAGAGCAGCCATCAAGGCCCTGGGCTCAGCA
CTAGCCGCTTCTGTCGCTGCAGCCAAGGTGACAGGTGCCAGCGCCGACCGCGCGCTGGTCATCACCTCGGGCACCAGCGG
GCTAGCCCCGAAGACGCCCGGCGAGCCAGCCACAGAGGACGACCAAGGCAGCCTGACAAACCCCATCTCGGTGGCTCGTA
ACCCATCTGAGACAGTCTGCCTTGACTTTGCTAAGCAGGGGGTGCGCGCGAGCGTCGTGCGCCTGCCGCCAACAACGTAT
GGCCCTGGAACGTCGGGCTTCATGTCTCTGCTCATCGGGACGGCGCTTCAGAAAGGCGTCTCTGGTTACATTAGCGGCGA
GGAGGAGGACAAGTACAGCTGGAGCGCCTGTCACAGAGACGATGCGGCGACGCTCTACCGACTCGCCATGGAGAAGGCGG
GCCAGTCAGGCGGTCCCTCCATTTTCAACGCGGTCAGCCAGCAGTCTGTGCACCTCAAAGACATCGCACAGAGTGTAGGC
AAACCTCTAGACCTCCCCGTTACTGGCATTCAGCCAGACTGGGCTGCCGAACACTTTGGCTGGTTCCAGGTTATCATGAC
AATGAAGAATGTCGTTTCCAGCGCCAAGACGAGGGAGGCGCTGGGATGGACTCCCACCAGCCCGCCGCTGTTGGAACATC
TGCCGATCATTGTGGACTTCGCCAAGTCGCAGACGCATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62