GenePrediction:GLEAN_2212 Details

Name: GLEAN_2212
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1475328..1476738 (+ strand)
Length: 1411
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1475328..1475748 (+ strand)
Length: 421
Type: CDS
Source: GLEAN
Position: GCSC_108:1475802..1476236 (+ strand)
Length: 435
Type: CDS
Source: GLEAN
Position: GCSC_108:1476305..1476738 (+ strand)
Length: 434
>GLEAN_2212 class=GenePrediction position=GCSC_108:1475328..1476738 (+ strand)
ATGCCTCCCTGCGCGTCTCCAGGGGGGCTCAGCCGCCGCGACGAGCTGGAGACGGCCAAGCGACAGTCCATGTTCCTCGT
CGGACTCGTCACGGTCGCCTTTTCGCTCTGGCCGACGCGTTTTATTCTCGTGCGCGACGCGATTATCGCGCTCTTCATGG
TCTGGGTCACCAGCAGGGTCTTTGACATGGTCGCCTTTCTCGACGGCACTTGGGAGAACGTGCCGTATTGGGTCAAGATG
CTGGTTCCCGTCGACCCCAATATCCAGATCCCTGCGCCCTTTGACTGCATCAAGAGTGCCGGTCACAATTCCCTGGCGAC
TGCGCGCCTCAAACTCCACCGGCTGGCTCCGGTGGCCAAGTACGGCCTCGAGGGGCTGCTGGCCGTCCTCGTCGGCCTGC
TCGACTGGTTTCTGAGCCAAGGTGAGCTGTCCGATCTCCGCTTTTTCACTAAGCTCCCCTGTCTGACAAAAAAGACTCCA
AAAAATCTCTGGAGCCCGAGCCGGCTTCGGGCCTGGAACAGTGGGTCAGCCTGCTGGTGGCCACGCCTCCAGAACACGAT
TACGGTCGCATCAACACGTCCAGTGCGGGCCTGCTCGAAAACGGATCGTCCCCGCCACAGCCCATTGCCTGGGAGAGCTG
CAAGGTCGTGACCTCATTGCCCTCCATCGCCACTCTGTCGACCTTCCGCGTCCATATGTCCTTCTGCCTGATTTCCCGCG
AAGTTTGGGAAAGCAAAGAGATCCGACTCGTGGACAAATTTAAAGCCGGGCGATACTGGGAAATCGGCGGCGGTAGAGGC
TCAGAAGACGGTACGGCCTGGTCATCGCGGCGGGTGCGGTCCATCCAAGCCATCCAAGTACTCGGGCTGCTCTCCAGGAA
AGCGAAAGCTGTCAGCACCTGTCAAGAGTGTACGTTCCCTCCGTCAAACACCGATTTTGACTTCTTTTTTTGTTATTTTG
TTTTGCTGACAAATCAGACTTTGCTGTCCTCCGACAAAACTGGGACTATCGCAAGATCTCTTGGAACGATGTCGACTTTG
CCATCATCCTAGGCTTCCTCGTGACCGGGCCACAGGCCACTACCACGTGCAAGGCCCTCTTCTCTCACTTTTCTCAAATG
CGCATTGATCAGGCCCTCATTCCCCGCCGCAACGACGCCTTTGGTCTCAGCATGGCTGCGCTTGGCGCTACTATCCTGAC
GGGCGGGCTTGCTACTCCCATCACCGCGCCTATGATTGTCGGCGGCCTGCTCCCGGTCATGGATACGGGATCGGACAAGT
CTTTGTCGCCACGCGATGCGGCAATGTGGCAACATCGCGAGGCTTCTTGCCAGAGGCTCCTCAGTCAGTTTCACGAGTTG
AGGTCCGTGTTTGGCATGCCAGTGGACCCTTTCGGCCAGTTTGACTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62