GenePrediction:GLEAN_2214 Details

Name: GLEAN_2214
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1479197..1480634 (+ strand)
Length: 1438
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1479197..1480339 (+ strand)
Length: 1143
Type: CDS
Source: GLEAN
Position: GCSC_108:1480396..1480501 (+ strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_108:1480570..1480634 (+ strand)
Length: 65
>GLEAN_2214 class=GenePrediction position=GCSC_108:1479197..1480634 (+ strand)
ATGGCGACGCCACGTACTCGTCGCGGGTTGGTTCCGGCAACGGCCCCGCCTCTGGACGAGATCTTTGCAGTGAACGGCGC
ATACGTGGCCGACACGGACGCGACCAAGGTCAACCTTAGCGTGGGCGTCTATCGGACCAACGACGGACAGCCATGGCCGC
TGCCGACGATCGAGGCAGTTGAGCACGAGGGGCAGGCGAAGCCGAGCCCGTTCCGGCACGAGTACCTGACGATCCAGGGC
GACGTGGCCTTTCTGGGCCTGGCGCGGGACCTCGCCTTTGACGTGGATGAGGAGGACGCGGCGGAGAAGCAGGCGGCCCA
GCCGGCCGATGACGCAGTCCCAGACACGGCCACCCACGTGCGCGAGCAGCCCGGACGGATCGTCTCGGTGCAGACGGTCT
CGGGCACAGGGGCGAACCACATGGGGGCCAAGTACCTGGCAGCCTACGTGCAGCCGGGCCACGTCTGGCTGCCGGCTCCG
ACCTGGGCGAACCACTACGCCATCTGGGAGCTGGAGGGCCTCGAGGCGCGCATGTACCCGTACTTTGACCCGGTGACGCG
TGGTGTCGACTTTGCTGGCATGCTGCAGGCACTCGAGCAGGCCGACGAGGGCGACGTGGTGCTGCTGCACGCCTGTGCTC
ACAACCCGACCGGAGCCGATCCGACGCCGCAGCAGTGGCGCCAGGTGGCCGACCTCTGCGAGCGACGCAAGCTCGTGCCC
TTTTTCGACCTCGCGTACCAGGGCTTCGCGTCAGGCGATGTGGCCACTGACGCCTGGGCTGTCCGTCACTTTTACGGCCG
GCCCCAGCTCGAGTTCCTCCTCGCCCAGTCCTTCTCCAAGAACTTCGGCCTTTACGGCCAGCGCGCCGGCGCCCTGCACA
TCGTCCTGCGCGCTGATGCCGACCCTACAGCCCACGGTGTCGTTCTCGCCAACGCCTGCCAGCTCATCCGCGGCGAGTAT
TCCATGGCTCCGCGCGCCGGCTCCGATCTCGTCCGCTCCGTCCTCCAGGTGCCTGCTCTGCGCCGCCAGTGGAAGGCCGA
CCTCGTCACCATGAGCGGTCGCATCAAGGCCATGCGCAAGGCACTCTACGAGGAGCTCGTGCGCTTGGGCACGCCTGGCT
CGTGGGTTCACATCGTCAACCAGGTGAGTTGCCCCCCCAGAAGAAAGAGACCGGTGGCTTGTCGGAACTGACAGTAAAGA
TCGGCATGTTCTCCTACACAGGTCTCACCGAGGCTCAGGTCGCGGCCGTACGGACAAAGTATCACGTCTACCTGATCAGC
TCTGGCCGGATATCCATATCTGGACGTAAGCACAGCCTATTTTTCCCTTCCACGGCCAACCACTCATCTATGTACTGACA
CGACACTATGCAGTCACAACCGAGAATGTCGCACACGTTGCCAAGGCGTTTGACGATGTCGTTCGGACGGTGAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62