GenePrediction:GLEAN_2217 Details

Name: GLEAN_2217
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1505739..1507031 (+ strand)
Length: 1293
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1505739..1506038 (+ strand)
Length: 300
Type: CDS
Source: GLEAN
Position: GCSC_108:1506103..1506473 (+ strand)
Length: 371
Type: CDS
Source: GLEAN
Position: GCSC_108:1506539..1507031 (+ strand)
Length: 493
>GLEAN_2217 class=GenePrediction position=GCSC_108:1505739..1507031 (+ strand)
ATGTCGTCTCTTGCCACCACAACGACGGCAGCGGCGCCATTTTACCCCTTGTCGGACGTCAACCACTCAGGACTCGTTGT
GTTGGCAGCCGTTATCTTCCTCATTTACGCCGTTCTCGGTGTCGGCGCAAAGCTAATCATCCGCTTCAACATCACCTCGA
TCAAGTCCCACGACGTTATCCTGTTGGTGGGAGCACTGCTGTATTTTGTCCAAACGGTCTGCATCATTGTCGCCTGCAAC
AGAGGTATCGGTCTGCACCAGGATACCGTTTCTGCCCATGACTACAATCAAGTCGGAAAGGTATGTCTGCTTCTTCTGCT
TCTTCTGCTTCTTTCCTGCTTTTCGTTTCTCTAACCGGTTCCAGCTTATTTACTGCTCTCGCATCCTGGCCATCATCATT
GAGGCCTGCACAAAAATCTCGCTCTGCCTTCTGGTCCGCCAAATTAACCATACGGGCCTCTTGAAGACGGCTAACCATAT
TCTGGGCGCCTTCATCGCTGTCTGGGCCGTCAGCGGCTCCATCGCCACCATCTTTCAATGCCACCTGCCCAGGCCCTGGC
TGGCCCTGAGCAAAGAGCAGTGCCCGAGTCGCGGTCCAATCTACATGTACAACGGCATCATCAACATTCTGACTGATATT
GCGCTCTGCATCCTGCCCATCGGAATGATGTGGGGGGTGCACACGACGCCGAAGCGCAAGATCGTCGTTGTCGCCCTATT
TGGCACCCGTATCATGTCAGTGCCCCTGTACCTGGCACCACTACACGCCTGTATTTCAGCAAGCTAACACTGCGCCTCAG
TGTCCCCGCCGTGACGATCCCCAGTCTCTCCACTGCTGCATATCTGTACGACAATTATGCCGACTCTACTTGGCACATCG
TCCCCAGCCTCATCTGGCTTCAAATCTCGCTCGGCCTCTCCATCCTGACAGCCTGCATCCCCAGCCTGAAGGGCATCGCC
GACAGTCTGCTGGGTGCAACTGCTGTGTCAGCTGTGCAGGCGCCTTACAATCTGCGCACCAACAACAAGACCACCGGCAT
CGAGCTGACATCACTTCGCGAGCCCGGTAGCACCAAGCACAGCTCAACCTGGGCTGCTGCCCGCGACGTGTCAAGCACAC
AGAGAGGCAGGTCCGGCCCCGCAAGTGGAGCAGAGAGCGTCCGCGGACTGACAGACGGCGTCGTTCACGTGTATGACGAG
ATCGATGTGCAGTTCGAAGACAACAAGCGCACATCGGCCTCGCACGACGGTTCGATTGAATCGGCCGTCTCAGAGTACCA
TCAACATGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62