GenePrediction:GLEAN_2218 Details

Name: GLEAN_2218
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1508589..1510262 (+ strand)
Length: 1674
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1508589..1508779 (+ strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_108:1508842..1509413 (+ strand)
Length: 572
Type: CDS
Source: GLEAN
Position: GCSC_108:1509472..1510262 (+ strand)
Length: 791
>GLEAN_2218 class=GenePrediction position=GCSC_108:1508589..1510262 (+ strand)
ATGACAAAGGAGGGCAGCCATCTCCGTCCGGAGAACGCCAGCAAGATAGAGTCCAACATCGATGTCTCGTCCGGCAAAGA
TGGGGATAACACTGGGGTCTACAGCCAGACGCGGACGCGGAAGCTGTTCTCCTTCTCCCAGCTCTTTGCCTTCTCCCTGA
CCTACATGTCCCTCTGGGAAGGCATGTGCACGTGAGTTCCGAGTCCGACCTACAGCCACCTGTCAGGCTAGTGTCTCCTG
ACAAACCCTCTAGGAATATGTACTTTGCCCTCTACAATGGGGGCCCGCAGACCTTCATCTTTAGCTTCATCATTGTCTTC
GTTGGCGCAATGGCACAGGCTGCCTCGCTGGGCGAGATGGCTTCCATTCAACCGGTTGCTGGTGCTCAATACCACTGGAC
CTACCATATGGCCCCGGTGCGGCTCAGACGCTTTGCTACATATGTCCAGGGCTGGTCGACTTGGTTCGGGTACATTTCGC
TGCTAGCGGGCATTGCCAACGTCACGGTCATCCTGCTCGAGTCCATGATCCAGCTCAACAATGACAGCTATGTCCCTGGC
GGCTGGCACACATCTGTCATAGTCATCGCCATGTGCGTCCTGCAGGGCCTGATGAACATGTACACCTTCTGGCTGATCCC
CTGGGTTGAGCTCATCGCTGGCATCCTGCATGTGTGCCTGTTTGTCATTTTTGTGGTCGTCCTCTGTGTCCTTGGAACCC
GGCACGACTCCAGCTTTTGGTTGGAACGCGATATTGCCTCAGGCTGGAAGAACACCTTTATTGCCTGGAACTTGGGCATG
CTCACCTGTGTTTGGAGCTTCACCGGTACGTTGTTTTTTTTCTCCCTCTTTTCTTTCGCCCTCCTAACTGTTTACTTTCG
CAGGCTTCGACAGTGCCATCCACATGAGCGAGGAGACCCGTAAGGCCAAGTCCGCGGTGCCTCGTGCCATGTTCTGGTCC
ATCTTCATGAATGGCTGCCTCGGCTTCGTCATGGTTAACATCATCCTCCTCACCATGGGCTCTGTCGACGACGCGATCAA
CTCGTCCAGCCCGATTCTAGCCATCCTGCTCAGCGTTACCGGCTCCAAGGCTGGAACGACGGCCATGATCACCGGCCTTT
TCATCATTTCCTTCAGCGTCAACTTAGCCAACATCGCTTCCGTCTCGCGTCTTACCTGGGCCTGGGCCCGAGACGGCGGC
ATGCCTTCGTACTTTGCTCACGTCAACAAGCAGCGCCACGTCCCCACCCGTTCCATCATCATGACCGTTTTTCTCGCTTG
TGCGCTGTGCCTGCTCAATATTGGCAGCGGCAGCTATATCGCTTTTGGTGGAATCACCGCTCTGTCATCCTTGGCTCTGT
ACCTGAGCTATGCCATTGCTATTGGCAGCATTCTCTACGCTCGCTGCACTACCAATACTCTAACCCTCGGCGAGTGGAAC
CTCGGACGCTACGGTGTCTACGTCAACGCATTCGCGCTCGTCTATACCCTCTATATCATCATCTTCCTACCTTTCCCCGA
GGCCATCCCCGTGACTGCGGCCAACATGAACTATGGTGGGCCGGTCATGGTTTTTGTCCTCGCCGTCACTGTGGCTCTCT
GGTTCGGCTGGGCTCGGAAGAACTGGAAGGGCCCGAACCTCACCATTCTCGACTTCATCCTTTCTAACTCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62