GenePrediction:GLEAN_2221 Details

Name: GLEAN_2221
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1529052..1530595 (+ strand)
Length: 1544
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1529052..1529147 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_108:1529238..1530444 (+ strand)
Length: 1207
Type: CDS
Source: GLEAN
Position: GCSC_108:1530522..1530595 (+ strand)
Length: 74
>GLEAN_2221 class=GenePrediction position=GCSC_108:1529052..1530595 (+ strand)
ATGAGCGTGGTCCGAGATGTCGACCAAGCCGGCAATGTGCTGTGTACCTACCACGGGGCCGGGAATGTAGCGGCCGGTGG
AAAGGATCTTCGAGTTGTGAGTGTGCCTCCTGCAGCCGCGTCTCGACCCCATGCTTTCCGGTCGGATCCCCGTTCATGGT
CTCTCTATCTGACAAATCTGCCATAGGAGAAGACAAAAGTTCCCCTAGGGAAGGCAATCTTTTATGCCTTCCTCCCGGCA
GGCTACCCCCAAAGCGTGACTGATGACTACCTCGCCTACCAGACGTACGACTCACTCCAGGCATTTTCATCCTCGATTGC
GTCACTACTCGCAAACCGTGCCGTACTCGAGGGTCTTGGCGTCGGCGATGCCTCGCAATCGCCCACTGCGGCTCTGGTGC
TGAAGATCATACAGGACACCTTCTCACGGATGGCCACCATTCTTTTCGCCCACCGCATGGGCCAAGCGATTGAACCAGAA
TGCAAGACATACCGCTTTATGGCTGACCTCTTTAACGACAGCGCTTTAATGCTGGACCTGCTCACACCTGTTCTGCCGCT
CTACCCCAAAGTCTGCATCATGGTGGCCTCGAGCATCCTACGATCACTGTGCGGCATTGCAGCCAGCGCAAGCAAGGCCA
GCCTGTCGGCGCATTTCGCGCGGACGGGCAATCTCGCAGAGTTGAATGCCAAGGAGGCATCCCAGGAGACGGTGATCAGC
CTGCTAGGCATGCTTGCAGGGACGGCTGTCGTTCACGTCGTACAGGACAAGACAGCCGTGCTGTACTGGATGGTCATGCT
GTTGATGGTGCACCTTGTGATGAACTACCGGGGCGTGCGTTGCGTGAAGATGCTGACGCTGAACCGACAGCGTGCCACCA
TTGTCTTCCGCGAGTACCTGGAGACGGGCAAGATCCTCTCGCCGGGCGAGGTGGCCGAGCGGGAGAGCGTGCTTCTGGGC
GGCCGGGGCAGCATGTGGAGCAAGAGTGGAGTCTACCACGGCTTCTGCGAATTTGGCAACTACGCCTCGGTGATGACATG
GTGGCCATGGGGCTACCAGCGGTACGGATTCGAGAACGAAAACTACTTCATGGCTATCTGGCATTGGGGCCCCAAGTTTT
TCATCCGCATCGCCATGAAGGACGGCACCGATCCCAGCACGGCGCCGCTGCTCGCCTGGCTGGACGCTGTGACGCATGCC
TTCCACTTCGACTCGGCGCTGAAAGATGGGCTCGGAAGCCATTATGAGAACGAGGGCCCGTTCGGTTACGTGTCGCCGGA
GACAAAGTTGTCGATACTGCGTGCATTGACGGCCGTAGGATGGGATGTGAACGACGCGCAGCTCGAGACCGCCAGTCCGA
TTCGAGTGCGCGCCGGAACTGGCGCAAACAAGTGTGAGTCGGCGTCTTTTCTGCAATGCTCTGATGAAATGTCTCTCTTT
AGGATATAAGCTGACAGGACATGAGATTAGCGCCTGCGACAATGGGGGAGAAGAATTCGGGTGGCTTTCACTACCCAACC
CAGGAGTTGTCGAAGACAGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62