GenePrediction:GLEAN_2225 Details

Name: GLEAN_2225
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1555012..1558129 (+ strand)
Length: 3118
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1555012..1555527 (+ strand)
Length: 516
Type: CDS
Source: GLEAN
Position: GCSC_108:1555590..1556562 (+ strand)
Length: 973
Type: CDS
Source: GLEAN
Position: GCSC_108:1556628..1558129 (+ strand)
Length: 1502
>GLEAN_2225 class=GenePrediction position=GCSC_108:1555012..1558129 (+ strand)
ATGAGCATGGCTGCCCCTCCCCGCCAGAGCCAGACGACCACGATGACCGCCTTCGCCTCAACCGCGTCACTATCGTCTCT
AGCAAGCACCGCAACAGTAACCCCGCCTATCAGCGGCCAGGTTGTTGCTACCAGTAACATTATCAATCAAAAAGCCGACG
CGTCCAGGTCGTTATACCAGATATGCGTGGCTCTGAAACAGCGGCTCGCCCAAGTACCCAGCTTCGAAGATCATATGCAA
CAGCTTGAGCAGCTAGAAACCGGCGAGGCCGGTGGCGATCCCGTGGAGGCATTATGGCAGATGTTCCGAAGCGGCTATGC
TCTGCTTGCCATATACAACGCATTGCAGCCAGAGCAGCCCTTGACTGTGGACGACGAGAAGGGCGACGACAAGAAGAAGT
CCAAGATTGCCATCTTCAAGTTTATCAAGGCTTGCATGAGCGATCTGCACATCCCCCCGTCCGAATGCTTTGTTGTAGGC
GATGTGACCAGAACCGACACGACCGGGTTTGTAAAGGTGCGTTGAAGATTTTCTTGCACTTGCGCCGCACGTTTTGTCCT
CTGTCTGACATGCAATAGGTTACTACCGTGGTAAACCATGTGCTGGATTTGGCAAAAGAGCGCGGCCTCCTTCTTCAAGT
ACAGCCGTATCCCGAGGATGAGGGCGCGGTAGAGCCGGGTGGCAAGCTCAGTTACCGCGATTACGTTGTTCGGGAGCTGG
TCGACACAGAGCGCAAATATGTTCAGGACCTAGAAAACTTGCATGACTTGAAAAAGACGCTCGAACAAAGAGGCATCATT
AATGGCGACATTGTCCACCAGATTTTCCTGAACATCAACGCCATCCTCGATTTCCAGCGGCGCTTCCTTATTCGAGTCGA
GACGACGAATTCAGTGCCACAGCTGCAACAGCGATGGGGTCAGACGTTTGTAATAACGGAAGAAGCTTTTGTTATTTACC
AGCCATTTATTGCCAACCAACGGAAGGCTGCGCAAATTGCACAGTCCCTCTTTGAAAAAATACAGTCGGCAGAGCATCCT
GTTGCCGTGGATTTTAACACACTAGACGGCTTCCTTCTGAAGCCCATGCAGAGATTGGTAAAATACCCTCTGCTGCTGAA
GGATCTTCTGAAGAAGAGCGAGGATGATGAGGAGAGGGCCGACCTAGAAGCGGGCATTGCTGCTGCCGAAAGGGTCTTAC
ATAATGCCAACAAGGCGGTCGATCGTGATTTACTGGACGAAGCGCTGGATGATCTTATGGACCGTGTGGACGACTGGAAG
AGCCACCGGGTCGAGCACTTTGGAAAGCTTCTGCTGCACGGCGTCCATACGGTTGTGACTGGAAAGAGTGACCAGGAGAA
GGACTACGAAATCTACCTGTTTGAGAACATCCTCCTGTGCTGCAAAGAAATCGCGCCAAACAAGAGCAAGGAGAAGAGAG
ACCGGACCAAATCGACCGGTCCGAAGCTCAGGAACAAGAGCGCGAAGTTGCAGCTTAAGGGACGCATCTTCATGAGCAAC
GTGACGGAGATTGTGTCACTTTCCAAACCTGGTAGGTTCTCACGGCAGCGCCAGGACACGAGGTTTGCGTGTTGCAGGAC
ACTGACAAGCATACAGGCTCGTACACTGTGCAGATCTGGTGGAAGGGCGATCCAGGTGTCGAGAACTTTGTCGTCAAGTT
CCAAACGGAGGAGCCGATGAAAAAGTGGGCAGCTAGGTTGGACGCTCAACGGAAGGTGAATGCTCCTCGGCCAGACCAGA
GTCCCGAGCAGGCAGCGCCGCCCGACTTCGCGTGGATGAAGACACAGGATGGCGGCGTCAATGCGCTCCAGAACCCGTAC
GCGCAGGAGGAGGAGGAAGAGGAAGAGGAGGAGGACTTGGCGCAGCAACTCATCCCCCCACAGTTTAACACATCGATTCT
CCGGGCGCGGTCTGCAACCTCTGACGGCACACAGTCGATTGTCGGCTTGATGCGGCAGCCTCCTCCCCGATTCCCGCTAC
CAGCTCCCCCGACACCACTGAGTTTGCAGACACAGATGACATCTCAACAGGCCCTAGCTTCGTCGCCAAACTTCCGCGGC
GGAGAATCCTACTTCTCGCCTGTTGCAGAATCGCCGGTGTCGTCCAGAACAAGCACCACGTCAGGCATGTTTCCTCCCAG
CGCAGGCTACATGTTTTCCAAATCGGGCACCCCACAGCCGGGTGGATGGGAAGGCGACGTCAACCGGTACACGGCACCAG
CAATGCCACGGGCCTCTTCTCGAGACGGCCCGTCTCCATCTAATGCGTACGGCATGGTCAACGGACGGAATCCTCGTGGG
CCATCCATGCCTGCAATGCCAAAGGAGCCACAGACACTGACGCAGCTACAACGCAGCCGCAGCTACAGCACCCCAGACAT
CAACGGCCAGCAGGCTCGGCGGACACCTGGCGGCAGCCAAGGGAATATCCCGGCCGTTCCCGGCATACCGCAGCATCTCC
ATGCGACGCACGAGAGACACGATTCGACGATCCCCAGATCGAACACTGGCAGCCCTCGAATCGATTTGCCGATGCGGTCC
AGTACACAGAGCCCAAGCGTACAGCAAAATCGGTTGCAGCCACAGCCAGGAGTCTCGTACGGGGCAACGATGGCCCAATT
CCCAACGCAGCCCATCTACCCACGACAGACGACTCCCGGTCCGTCCGGCGCGTCGCAGCAGAACGGGACAAACCCACAGC
ATGTGCCGACCCCATTATCGCTGAACGAGCCGGTTTGGGCACCTGCATCACCACCGCTGGGAACAGGAATGTCGCTCGGG
ATGATGGACTCGGACATGTTGGCACCCACCCAGCTCAAGGTGAAGGTGAACTACGACTCGTCGAACTACATGACACTGGT
GGTGGCTTTCAATATCACGTACCAGTCTCTGATCGACCGCATAGACGCGAAGCTGGCGCGGTTCACCGACAGCAGCATTG
GTAAGGGCATGCTGAAGCTCCGGTACCAAGACGAGGACGGCGACTTTGTGAGTATCGGCAGCGATGACGACATCCAGATA
GCGTTTATGGAATGGTGCGACGGCTTGAAGAACCAGTACAACGCAGGGGTTAGCGAGATTGAGCTTTTCTGCGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62