GenePrediction:GLEAN_2226 Details

Name: GLEAN_2226
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1559802..1563683 (+ strand)
Length: 3882
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1559802..1560135 (+ strand)
Length: 334
Type: CDS
Source: GLEAN
Position: GCSC_108:1560199..1561637 (+ strand)
Length: 1439
Type: CDS
Source: GLEAN
Position: GCSC_108:1561995..1563683 (+ strand)
Length: 1689
>GLEAN_2226 class=GenePrediction position=GCSC_108:1559802..1563683 (+ strand)
ATGCCTGGATTCAAGGCAGACCTCGCGAGCACTATCACAGCGGCCAACTTTGCCGCACCTCCACTCCCACACCCCCGAGC
GTGGCAGCGCGTGGCCGTGTCTGCGACGACCAGCAGTCTTGGCCTGCGCAAAATATGGAAGCGGGTCGGCGGTATGGCGC
CCTCACAAGACGACGACCGATACTTGGCGGCAGTGCGTGAGCTGCAGTCCGACAGCCGCAGCCCGAGGAAGCGCAGACGT
GAGCTTCGACACGTGCCCGTGTGGGCGGAGGCGCAGTGGCACCCACAGGACGTGCAGTATGCAGATGTAGAGATGGTGCT
TTCAGAAGCTAGAGGTATGTGGCAGCGCTTGGCCCGGAGACCGCGAGGAACGGAGATGCTGACACCATTGCCAACAGAAG
CCGTGGCAACTGCGACAGCCGTGGGCATCACGGACGCGACGAACACCATCCATCTGCGACCTACACGCCGGACAGCAACT
TTTGCCGAGGACAGTCTCAAGGTGGTCCCGAGAAAGAGGAGCAGCAACCGTAAACCACTACAGCCTATGTGGGCGAAAGC
TGCGACAAAAACGTCCAAGCCTCAGCCTCTGCCTGAGAGCGTGATTGTCGAAGAAAAGCCTCAGCTGGAAATTGAGATTC
ACGTGGACGAGACGGACATGTCACACATCGCAACGCGGCGGAAGCGTCGGGCAAGTCGCAGGTACAGCATGCCGGCCAGA
CAAAGATTTGACCAGATGGAGGCTATAGACATGGACAGTCCTCTTCGCCCGGCGAAAGCATCTACCCTCAACGCCCCAGC
ATCGTCGCCGCTAAAGCCTTTTAAGATGAGCGACACTCTGTTGGCACCGGTCAGCACAGTCCGCGAATCGATCATCCTCA
AGGAGCACGATGCGGTGGCGCCTCCAGACGACGCGCCCGCTCCGCTTATAATCTTCGACCAGGCCGTTCCCGAGACAGTC
ACGGAGCCGGCGCATGAGAGACGACGGCGCAGATCTCTGCACAGCGGCAGACACAGCGAGAAATGGACGGAAGCCGCGGT
GGAGAAAAGACTGAGTGCCGGGAGAGCAAGACATGCACGCAGAAGCATGGGTGCCGAGCTGCTGGTGCCAAAGTCCAAGA
AGTCGGCTCGCCGCCACAGCGCCCATCCAGGAACGGGCGCAGAGAGTTGGGCAGGGCGGCGCAGTAGCGATTGCGAGGCG
GACCGGCTTGTGCACGAGGACGCAGCGTTGCAGCTGCAGGAAGAGACGGCAAGCGCTAGCAGTGGCCTGTTAATGGTGCT
GGAAGAGGAAAGCAGCGTGATGCGCGAAGAACCCGTCGTCGTGGACGTGCGCGAAAATCTGGACATTTTCGGTGCTAATC
CTCCCATCTATCCACTGACAGCTGGCAACGCGGAGCCAAACAGGGCAGCCTCTCCACCCGACAGCGGACTGACATCAGAG
AATGAGGTCGTGACGGACGAGACGCTGCACTTTGACCTGGCCGAAACGTCAGCTGCTGATTCCGATGTTCGGCCGAAGTT
AATGTCGTCTCCTGACACCGCTAGCAGAAGCGGACAATTTGATGACGAGGAACTGCCGCAATCGCCGAACATGACTGCTG
CAGGGTCTCGTGATGCTACTGGTCAGAATTTGGCACTGTTGGCACCGTTGGTGCCCGACGACACGTTGGAATATGGCACA
GCTCGGTTCGTTGGGGGTTCTGCGATACCGCCGCTGGCAATGGAGATCGACTCGGATGCCGAGGAGACTGAGGGGGACGA
CTCTGTCCTCGAGCAGCAGCAGCAGAGCGACGATGCCGGCAACGACGACGACGTGCCCAACACACCTGAGCCGTTTGTGA
GCACGCATCTGCGCTCACCGGGCTGTCTTTCGCCAGCAGGCAGAGCTGCGGGCTGTTCCGGCATCGCTAACGCAGACGAA
GAGGAGGAAGAAGAGGAAGACGACTACGAAGGCTACGAGGACGCAACAGCGACGATGACGACTGAGCTGCAGGACCTGAG
CGAAGACAGCCTCTCAGCTCAGGACGACTCGGAGACAGAGATGCTGCGCAAGTTTGTGACGCGAGTGAAGGCCGACAAGA
CAGCGAAAGCAGCCGCAGCAGCAGCAGCCGCAGCAAGAGCCGCAATAGCAGCACCAGGGACAGCCGAAATGCCGGCAGCG
ATATTGAAGCAGAGGACGCACCTGCGGCCGAAGCGGAAGTCGGGGTCAATCGGGTCGACCGCATCGTCGTCGGGTTCGCC
GGTATCGAAGAAGGCAGACGAGGCGTCTTCGTCGCCGTCTTCGTCGCTGATGAAGAACCGGATGCCATTTGCGAAGAAGG
ACCTTAACGCGAGTCCAAGTCCGCGGAAGAAGCGGAAGAGCCTCCTCGATGGCGGCAGCAGCAATAGCAGCAGCGGCGAC
AAGGAGGCCAAGGCCGGAAAGACACATCGATTGCGTGACCTGCTGAGTGCGCCGTCGCTGGAAGACGCGTCGCCGCCGCG
GCCGAAGAGACGGCGCAAGAAGATGGAGGCGGATACAGGAGGCATCTTCAACCCAGAGTTTCTGCCGGCTGGTGAGAATG
TGGATGTTGGAAGTGCCGATGCTGCGACAACTGCGGAAACTGTGGAAACGACGACGGAAGCGGCCACGGCAGAGGAGGCA
GGGCTGCGACGGTCGAAGCGGACAACACGCAGCAGCCAGACAGCCAAGTCGGCAGCAGCAGCGGCGGTGTTGGCTGGAAG
TAGCGGTGCGCTGTCTCTGCTGCCGGTACGGCTGCCGGGTTCGTTGAACCTCCACGGCGATGAAGGTCACGTGACGGGGT
TGGTGTTGAGGCGCACAGGCGAGAAGGACGTGGCAGCGATCACGCGAGTAAACACGCGCAAGAACAGGGCCGGCGCAGAA
CATCCGTCGGCCGTGTTGGCACGACAGGCGCAGGAGTTAAAGGGGAAGAAGGGGGGGAAGGGAGGAAAGGGGAGAAAGAC
AAAGGGTGAGAAGAGCCAGAAGGGCCAGAAGAATCAGAAGTCGGTCACTGACACGGCAGAAGGGGGGAGTGAAAGCGAAG
ACAAGGACAAAGAGAGCGGAGACCAGGGTGAGGTTGAGGGCGAGATCAAGGACGACAACAAGGACGAAGAAAACGACGAG
AACAAAGACTCGAAAAGTTGCAAAGCAAAGACTGTTCGCTGGGCTGAAGAGCTAGTCCGGGTACAAGGCCGCGAAGGCAA
GAGCAAGAAGGACAAGGGCAAAGGAAAGAAGGACAAGACCGACAAGGGAGCAAAGGGGTCAAAGGAAGAGAAGGAGCAGG
TGGCGGAAAGGGTCGAACACGTGGAGAAGGTCGCGGAAGCCGAGTCCTGTGCAGACGTCCAGGAGAAGCAGCCGAACGAG
GCGCCAGCAACGGCTGCTGTGGCTGATGAGGTGGCTGTTGATGTGGCTGTGGACGTCGGAGCTGTAGTGTCTGTGGCTGA
ACCGACGGAGGAAGCGACCGTGGTGGATTCTGCAATAGCAACAGCAACAGCAACAGCGACGGCCGAGCCGGCGAAGAAAA
AGGCCATACCGCGGCGGACGACGCGGACGTCTCGGCTGCAGCTACCAACGCCCCGCAAGGCTCTTCTATCGGCTGCGGCC
GCGGCAGCGAAATCGTCGGCTGTGAAGCCAACAGCAGCCAAGACTTTGGCAGTCAAGGGAACGGCAGTCAAGGCGACAGC
TGTCAAGGCGACGGCGGTCAAGGCGATGGCGGCCAAGGGAACGGCAGCAAAGGCGACGACTGCAGCGACAGCAGCTGCGG
ATGCTGCTGGCCAGAGCAAGTTGGCTATGCCGCGGATGGCAACACGGCGGACAAACATACTGAGCATGGGAATCAGCGGG
AACGGCACGCCGGCACCGAAACGACGAGCCGGAAGGATATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62