GenePrediction:GLEAN_2227 Details

Name: GLEAN_2227
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1568413..1569931 (+ strand)
Length: 1519
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1568413..1568866 (+ strand)
Length: 454
Type: CDS
Source: GLEAN
Position: GCSC_108:1568928..1569931 (+ strand)
Length: 1004
>GLEAN_2227 class=GenePrediction position=GCSC_108:1568413..1569931 (+ strand)
ATGGCGACCGGCCTCGACACCGAGCGGCTGCGACTCGCGTTTGAGACGCGACCAGACCTCGTGACCGGCATCCAGAAGGC
AGCAGACTCGCCGGCGCGTGTGGCCCTCTTCAACAGCATTGCCAGCTTTGTGTGCGACCGGCTGCAGGGCGACGACGAGC
CGGCCGTCAAGCGCAGGCGGGTGCAGGCCAACGCGGCCGCAGCCAGCAACACACACACAAACGGAGGCCTGCCTGGACGC
CCGGCAACAGGGGCAGATGGCGGAGGAGTATCGGCAGCCGGGCTGGCGACAGCGGCGGCGGCCGAGACACCCATCCTAGA
GATCAAGGACATCTCGCTGTCGATGCCGCAGCGCAAGAAGCTCGACCTCTGCTTCACGCAGCACTACCTGTATGCCCGGG
CAGCAGGCACGACGGCCCCGGTGCAGGGCATCGTCTATGCCTGGACGGACATTGGTACGTGTCCATGGCGGCTGCTCCGC
TTTCCAGCAGTCTTGTGTGGCAGCTGACAGGACAGAACACGTCTTTTGCGTGCCGGTGCCCGACAAGGCGCAGGTGCAGC
ACAGCTATGTGCTCCTGCCGCGCGGCCAGGCGCTGGCATCGCTCTCCAAGACGACGACGACGCCGAATGGCACGGCCGGC
CTGCCGGAGCCGCTCGTCTTCACCGTGCCGGCCGCGGCGCCCAAGCCGGGGTCTGTGGGCGGCACGGCAGCGGGCGAGGC
GGCGACAGTGGCGGACGCGTACAACACGCTGCTGCACTGGGCGCTGGAGGGCCGGCTTCCCAGCAGCAGCCAGATCGTCA
GGACCGACGCCAAGGTGTTTCACAGCATGGCGCGCCAGGCATACCGGCCGAGCGAGAAGGCAGTGCACGTGCGGGCCTTC
CGCGGCAGCAAGGACGGCTTCCTCTTCTTCCTGCCGACAGGCATCCTCTGGGGCTTCAAGAAGCCGCTGCTCTTCCTTCC
GCTGGACCGTGTCGAGGCGGTCAGCTACACCAACGTGCTGCAGCGCACCTTTAATGTCGTCGTCGAGGTCGATGTTGGCG
GCGGCCGCACCGAGGAGGTCGAGTTCGGCATGCTGGACCAGGAGGACTACGGCAGCATCGACGAGGCGTACGTGCGGCGA
CACGGCCTGCAGGACCGCAGCATGGCCGAACGGCGCAAGGCCAAGCGCGAGCTGGCCGAGAACGCAAAAGACGGCGACGG
CGATGGCGACGAAGGCGAGGCCGAGGCTGAAGATGAGGCCGAGGGCGGAGGTACCGAAACGACCGACGGGGTCAAGCAGG
AGGGGACAGCAGCACGGCCCAAGACGGAACAGGAGCTACAAGACGAAGAAGACGAGATGGAAGAGGACTACGATCCCGGC
AGCGACGACGACAGCGGGGGCTCCGGTAGCAGCGACGGGTCTGTTGACGAGGACGAAGACGACGGCGACGGCGACGAGGA
GGACGAAGACGAAGACATGGAAGACGGGGAAGAAGAGGAAGAAGAGGGCTTCGACGTCGTCGGAAAGGCGGAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62