GenePrediction:GLEAN_2229 Details

Name: GLEAN_2229
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1587070..1588900 (+ strand)
Length: 1831
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1587070..1588111 (+ strand)
Length: 1042
Type: CDS
Source: GLEAN
Position: GCSC_108:1588292..1588373 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_108:1588444..1588900 (+ strand)
Length: 457
>GLEAN_2229 class=GenePrediction position=GCSC_108:1587070..1588900 (+ strand)
ATGTCCATTCCCAACGCATCACAAGACGCCCACGTGCCGCCGCCACTTCCGCCACCCAGGATCGTTCCCGTCATTGGTCC
CAAGTCGGCGTCAATCGAAGATTACCGACCACGAGAGCCAGAGCCCATGGAGGAGATGCCCAACTATAAGACCCGGCAAG
ACAAAGATGAGGGATACTACTCTATGGGGTCGCGCAGTCGAGATCCGTTTGGCTCTGCCAAGTTCGGCCTGTTCCACGAC
CACTACCAATTCAAGTCGAGCGCCGATGCCTACGACAGCTTGCTGCTGAAGAAACTGGATTTGCGAAGGGGGTTGGAAAA
TCGGTCTCCACCACGACATGGCGGCTTGCTGAGCGCGTCAGCTCGCGAACCTCTCCGACCGGTAGACCGCTTTCCCACTC
TGCAGCCGCTGTCTCTACCTACTCGCATGAAACAGCAACAGCAACATCAGCAGCAGCTTCAGGGCCAGCTGCTCGACTCG
CCGAACCGATACACAGACACCCCTCTGCACTCTGCCGTGTCCCCCCGGAGTGCACCGTTCGGCCACTATCCCAATGGCCT
CCGATCACCAAAGAGGGAGCATTACGAATACGAGCGGTCGCCGGAAGCACAGACGTGGAGGACTGCTAGCAGCTCTAACC
CTGATGATGCGTTCAATAGTGGCTTTGGCGACGACGATACCGGCTTTCCAATGGAGGAGACTAACCGCCTGCGGGAGTTC
CACTTGGCCAGCGAATACGCGTCGGTGGGTCAGAAGCGCCGAGCATCGTCGCCACCCGTGACCGAAGAGCCAACTATTCC
GCTGTATAGTATGTCCTCCAGCGAGCACCTTCGCTGGCGTGAGGGAGTGTCTCGCGGCTCGCCAGCGCCCCGGCTCTGTG
CAACTGCACAGGACTCCATATCATCAGTCTCATCTGTCGGCCTGTCTGTCAGCCGTACAAGCTCTTCGTACAGCAATTTG
TCCCCGGCAGGCACGAGCATGGCCAGCGGTTGTCTCACCTTTGGCCGGAGGTCTCCGTGTGACGGCCACTCGCCTGCCAG
CGGTATGTCGCCTATCGACACGGCTGGAAGCGGGTGCACGTCACCGTATTCCCCCTCGATTTCCCTAACCCTTTCTCCTC
GGTCCGCGCTTTCACGCACACCACACCACCGCACCTTGAGCGAACAAGTCCGAACTCTTGCGTCGCCGACACGGAGGGCG
CCTGACATGGCGAAAACCACAGGGTTGCTGAAGCGTACGGACTTCTTCATGTGCGAATGCTGTCCCAAGAAGCCAAAGAA
GTTTGACACGGAGTCACAATTAAGGTAAGACACTAACACTATCGTCTGAGATCTTGTCCTTTTCGCATGAAGACTCTAAC
AAGCAACGGTGTAGATCACACGAGATGGAGAAGCAGTACGAATGCAACTATTGTGGCAACCGGTTCAAGAACAAAAACGA
AGCGGAGCGACACCAAAATTCATTGCACGTACGGCGACACAGCTGGTCTTGTGCAGCACTGTCCAGCTATGACCGGGCCT
TCCACGAAAGCACATTCCGGCCAGGAGAGGCAGACACGTGCGGGTACTGCGGCGAAGAGTTTGCACGGAGCGGGTGTGCG
GCCGGACGGCCAGATGCTCGGCACGCGACGGAGCAGGACTGGGATGACCGCATACGACACCTGCAGGATGTGCACAAGTT
TCGCGAATGTAATGCCAGCAAGAAGTTTTTCCGGGCTGACCACTTCCGTCAGCATCTGAAGCACAGCCATGCTGGAACTA
GCGGCAAGTGGACGAATATGCTAGAAAATGCCTGCATGATGGAAGAGGAACCCCCGCTTCCAGTGCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62