GenePrediction:GLEAN_2230 Details

Name: GLEAN_2230
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1589753..1590980 (+ strand)
Length: 1228
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1589753..1589799 (+ strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_108:1589873..1590106 (+ strand)
Length: 234
Type: CDS
Source: GLEAN
Position: GCSC_108:1590191..1590980 (+ strand)
Length: 790
>GLEAN_2230 class=GenePrediction position=GCSC_108:1589753..1590980 (+ strand)
ATGCCGCTCGACAGAATACCTGGGGAGGACCAGCTGTACATTGGAAGGTGAGACATCTTGGGCAGCGAACCCTCTGAAAA
ACAGCGCTGCTGACCAGACCCCCTCCCTTCTCGTTTTCAGTGCCTTTGTCCTCGGCCAACAGAAACTTCTCGACACCCAT
AATATCACCCACATTCTTTCCGTCTTACAATGCACACCGCGTGACGAGCCCTCTGGTAGGAAGCGCCAACGCTTATGCGT
GGATGTGGATGACGTCGAGGAGGAGGACCTGGTGGTGCACTTTCCGCGGTGCGTGCGTTTCATCGACAGTGGCTTGCAGC
CCTCCTTACAAAATGGCGACGCGGCCGGTGCAGTGTACGTCCACTGCGCTATGGGAAAGTCACGATCAGCCTCGGCTGTG
ATAGCCTACTTGCTGTGGCGGTACCCCGACCGATTCAGACCTGCCGCGAGCACCGTGGGCGATGTGGGCGATGCAGCTGT
CGATGCGGACAAGGCGGTTGCGCGTGCGCTTGCTCTCGTGCGCGAAGCACGGCCGATGGCGGAGCCGAACGCGGGCTTCA
TGCGACAACTGGCGCTCTGGTGGCGCATGGGCTGCCCGGCCGACACGGACGATGCGGTTGAGCGGCACCCAGCCTACCAG
CGATGGGCCTATCAGAAGGACGTGCAGGAGAGCGTGCAGCTAGGACGGGCGCCGGACCGGCTCTGGTTTGGGGACGAGGC
ACAGGACACAGGAGCACCTGTGGACATTGCAGGCATTGCAGGCGGCACAGACAGCTCTGCCAACACAAAGCCGACCGGCT
TCCAGCTACGGTGCAAAAAGTGCCGTCGCGTGCTGGCGGAACCTCCATTTATCCAGGCGCACGAACCAACACAACCACCG
GTGGGAAACCAGGGCTGTCCACACTACTTTGTCGAGCCGCTGTCGTGGATGCGGCCGGTGCTGGCCGAGGGTGCCCTTGA
GGGACGCTTGGCCTGCCCCAACACGGTTTGTGGCGCCCTGCTCGGTCGCTACGCCTGGCAGGGCTTTCAGTGCAGTTGTC
GCACCTGGGTCTGCCCGGCCTTCTCGCTGCAGCGTAGCAAGGTCGACCAGGTGGTGCACGCCTCCTCGCAACAAGGGGGT
GCCGCGGCTGTGGCTGCCCGCTTCGGCATCCGGCTGCCGCCAGGCAGCAGCAGCATCAACAACACAAGAGCAGCAGGGGG
CAATCCAGTCCGGACTGAGAATCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62