GenePrediction:GLEAN_2231 Details

Name: GLEAN_2231
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1604546..1605790 (+ strand)
Length: 1245
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1604546..1604699 (+ strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_108:1604826..1605202 (+ strand)
Length: 377
Type: CDS
Source: GLEAN
Position: GCSC_108:1605365..1605790 (+ strand)
Length: 426
>GLEAN_2231 class=GenePrediction position=GCSC_108:1604546..1605790 (+ strand)
ATGCTGCCTCCTGTGGAGGAGTCGGTGCTGCAAAACAACCCTGACTTTGCGAAGCTGTACAAGATCCTGACTACGGTCGT
TCTCAACGAGGATGGATCGAGCAAGAGCGACGTCGGGGCGAAACAGCGGGAGGCTGCTCAGCAGGCAAGATACAGTGCAG
ATGCCGAGCTGTGTCGCTCTCAATTGCAAGGCATATTATACTGACGCGATTTTCAGGAGTTGAGAAGCGTTCGGCTGAGG
GAAGCAAGAAGGCACCTGATTGTGGAGGCGATCTCGACAGCGGCACCTCAGGCACCAGCAGCCGATGTGAAGTCAGGAGC
TGCAGCAAGAAGGGCAGCCAGGGCGAACTCGGCGCGTCCTTCGATGGTGATGAGGGAGGAGGCACCGCAGGAGGCAGTGC
CACAGGAGCTGGCAGATCTGCTAGTGCTGTTGCCGGCTCTGCTACAGCGGGAGCGTGAGGGGAGCGGTGGTGCAGGCGAG
GGAGCGAGGCTGTCGAACGACGACGTGGCTCTGCTGATGGCGAGTCCTCCGTTGTCACGGTTGCCGGAGCACCTGCCGCG
GCTGGCCCAGCTGGTGTCGGCGAACCTGCAGGCGGCAGCGCTGGCACTGGTGCGGGTGGCGAATCCGATGACGAACCCGT
CGTATCTGCACCGCGGCGTGACAACACTGGCGAGCCAAACAACGACGCTGCAGGCAGCAGTGGCGGCGGCAGAGATGCGG
CTGGCAGCGGCGCGGCAGACGACTGCGACAGCGGTGCTGGGGCTGCTGGACCAGCAGTCGACGGCGCTGGCAGCGCTGCT
GCGGTCGCTCGAGGCTAAGCATGGGCCGGTGGGCCGAGCATTGGAGCTGCGGGCGGCCGAGGTGGCGCTGGCGGCACAGA
CGAGCGAAGTCCAGGCGCGATCAGCACTGGCGACCGGCCGGCGCGTCCTCTACCCGCCCGAGGCCGTGGCTGCTTTGCGG
CGCTATGCTAACCATCTGCGAGACGGCCGGATGCGGCTCGACGAGGCGCTTCGCGAACGGAGAGCCGTGCTGGCTGACTA
CGGCATCGAAGTCGACTCAGAGGATGAAGCAACGGCAGCAGCAGGAGGCTCCGAAGCAGATACCGAGGCAGAAGGAAGGC
AGCGGAAGACGGGCGCACTGACCGGAAAGGAAAAGACAATGCGCGAGATGGCCCGCGTCTACCGGCAGATGGAACAGCAG
ATGCAGGAAGTGCAGAGCGACTTGGCTCGGCTCGGGAGGGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62