GenePrediction:GLEAN_2232 Details

Name: GLEAN_2232
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1612059..1612367 (+ strand)
Length: 309
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1612059..1612128 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_108:1612189..1612367 (+ strand)
Length: 179
>GLEAN_2232 class=GenePrediction position=GCSC_108:1612059..1612367 (+ strand)
ATGCATGTCGCCGGTCTCGTGTATCTAGCGGCCATTGTCGCTCTCGGCGTCCAAGCCGTACCTGCTCCAGGTATGTATAG
AAATCCTAAGTTTGTAAAATTTGTCCAAACTAATTATTCAGGTCTGTTAGAGAGCGTCAAAAATAACCGGGCTGATGCCG
ACGAAGCCTGGGGATTCCACACGGACCGCGTTAAGCGTGATGATGCCGACGAAGCCTGGGACTTCCACACGGACCGCGTT
AAGCGTGATGATGCCGACGAAGCCTGGGGCTTCCACACGGACCGCGTTAAGCGTGATAATGCCGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62