GenePrediction:GLEAN_2233 Details

Name: GLEAN_2233
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1622270..1623787 (+ strand)
Length: 1518
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1622270..1622390 (+ strand)
Length: 121
Type: CDS
Source: GLEAN
Position: GCSC_108:1622616..1623787 (+ strand)
Length: 1172
>GLEAN_2233 class=GenePrediction position=GCSC_108:1622270..1623787 (+ strand)
ATGTCGACAACACGAGGAGCAACGCCGTCGAGACTGTCGATGTCCACGTCGCCGCCAGCTTCGGAGAAGTCGCGGCCGTC
AGGACTACGCGTATCTCAGCGGCCACCGACGGCCTGCAGAGGTGAGAGCGGCCGCGAAATGGGGCGTTGGTGCCAAAGCT
ATGACCATTCGAGCACAATGCGTGCAGTGCAGTGCTGATGGCGGGTGGCTGACCCGGAAGCAGAATGCTCTCTGCGCAAG
GTACGATGCGATAAGCAGACGCCGTGTGGAAGGTGCATGCGGCTATCACGGCGGTGCACGCGCGAGGTGGTGCGAATCAG
TAAGTCCCTATCGCTACACCGGGAAGAGCTGCAATTCTTGCGAGGACTGCGGTCGCGCCTGGTGGTAGCTGGTAGAAGCG
GTAGTAGTGGAGATGACGGGACGCAACAAGGCAACGACTGGGATATGCGACAGGCAGCCGTAGCGGATATTGATGCTCGC
GTGCGGTTGCTGGAGCACGGAAAGGCAGACGACGAGGACGAGGTGGTGGCCATGGTGACGCCGAGCCCGGAGGCAGGACC
GGAGATGGAACAGCAGCAGCAGCAGGTGAGCTATGGCACGATAAACGGAGCGAACATCCCGAGCACGAGGTCAGCGCGGC
CGTCTATTCCAGTCAATATAGACAGCAGCAGTCAGGCGTCAGTGGTGGTGGCTTTTGAGTTTCTGGCGTGGGGACGAAAC
ATTAAAGGATGCTTTCCTCACCGGCGATGCAACTGCTATCAGCACCGACGATATTCGGAGCTGGTGTCAATCAACTGCGA
CGAAGCGTGGGTGGGCCGGCTGGCAATGACGGTAACAGTGCCAGTAGACGCGGACGTGCTGCTTCCAGCAGCTGTGGCCC
GCAAGGTGGTGCAGTTCCACTTGAACCATCTGCACTGGCACCACAACGCGTTCCACGCGCCAACCTTTCTGGCCCGCTGC
CAGCAGTTCTGGAGCACAGGTACGACAGACCATCCTCTGTGGCTGGCGCTGTACCTAGCGGTGTGCAGCGTGTCGCTGTG
GGCGCTGCTGAATGCGGAACGACATCGCGAGGCTCTGGGGCTCGACAACGGCGCCGCTGGTGGCAGCCTCGCCGACCTGA
ACGAGGCACTGGTCGAGCGGCAGTTCCAGGCTATGGTGGCCGTTCTGTACGGCGGAAACTTTCTCGAGCACCTATCGCTG
TACTCGGTACAGGCTATTGTCATCTCCACGCACATCGCCCACAACCTCGACCGCAGCGAGCTCAACGCCACGCTGATTGG
TGCAGCAGTGCAGATTGCCCACAGTTTAGGCCTGCACAAGATCTCCGACCCGCCGACGCTCGAGAACGGTGGCAAGGGCA
CCGACACGGCTGTTGGCTGGCACGAGCGCGTCGAGATCGAGACCGGCAAGCGCGTGTGGGCTCAGCTGCTGATCCAGGAC
CACTTCCAGATCCCCTTCACAAACAGCTATGGTGGGTGGCGTGTGCTTCGATCGCGATCTGGTATCAGTGCCGGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62