GenePrediction:GLEAN_2235 Details

Name: GLEAN_2235
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1634163..1636447 (+ strand)
Length: 2285
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1634163..1634210 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_108:1634309..1634700 (+ strand)
Length: 392
Type: CDS
Source: GLEAN
Position: GCSC_108:1634752..1636447 (+ strand)
Length: 1696
>GLEAN_2235 class=GenePrediction position=GCSC_108:1634163..1636447 (+ strand)
ATGGAGGCTCTCAAAGAGACGTTTAGCCGGTGCAAGGCTGAGACGAGGGTACGTTCAAGCGATCTTGTCGTTCCCTTTGA
GCGGCGAGACTAAGCTAGCAATGACAGCAGTGGCGCCGTGGCTAATACGATGTTGCGTGGAAGCAGGCTGCCCTCGTCAC
CTATGTCACGGCTGGCTACCCGACGGCAGCAGATACACCGGAGGTGTTGCTGAGTATGCAGCGAGGTGGCGCGGACATTC
TGGAACTCGGTGTGCCGTTCACGGACCCGATCGCAGATGGACCGACGATCCAGACGGCCAACACGGTGGCACTGGAGAAT
GGCGTGACTCTGACGGACACTTTGCAGATGGTGCGGACGGCACGGGCCAAGGGCTTGTCGGCACCGGTGCTGCTGATGGG
ATACTATAACCCGATGCGTGCATACGGTGAGGAGGTGCTGATCCGCGACTGCAAGGAGGCTGGCGTCAATGGCTTCATCG
TTGTGGACTTGCCGCCAGAGGAGGCGGCAACATTCCGGACGTTGTGCAGCGCAGGAGGGTATGTATTCTTGTATCTTCTA
TCCTCTTCTCTTCCCTGCTGACTTTCCAGTCTCTCTTACGTGCCGCTCATTGCACCGGCCACCTCAGATGCCCGCATGCG
GATCCTCTGCCAGCTGGCCGACTCGTTCATCTACGTGGTCTCGCGGCAGGGCGTGACGGGCGCGTTGGGCACGCTGAATG
AAAACCTGCCGCAGCTGGTAGCGCGCGTGAAGAAGTACAGCGGCGGCAAGCCAGCGGCGGTGGGCTTTGGTGTATCGACG
CGCGAGCACTTTGTGTCGGTGGCGGGCATTGCAGACGGCGTCGTGGTCGGCAGTCAGATCGTGACGACGCTGCGCACGGC
CACAGGCGACAAGCACAAGGCGGTCGAGAACTACTGCGCGTACCTGACGGGCCGGACAGCTACAGCAGTGGCCACGGCCT
CGGCGGCAGCAGCAGCGGCAGCCGTGGCTCGGGCGGCACCCGAGACGCAGACGCAGACGTCGGCAGCAACAGCACAAAAG
CTCGACAGCAACCTGGTGGCACAGCTGGCGGCACTGCACGACAAGATGCCAGACCGGTTCGGTCAATTTGGCGGACAGTT
CGTGCCGGAGTCGCTGATGGACTGCTTGTCCCAACTCGAGGATGGCTTCAACCAGATCCTGCACGACGACGCCTTCTGGA
AGGAGTACCGGTCCTACTACGAGTACATTGGGCGGCCGGGCCACCTGCACGTGGCTGAACGGCTGAGTCAGCACGCAGGC
GGCGCCCAGATCTGGCTTAAGCGCGAAGACCTCAACCACACAGGCAGCCACAAGATCAACAACGCGCTGGGCCAGATTCT
GCTGGCGCGGCGTCTTGGCAAGACCAAGATCATTGCCGAGACCGGTGCCGGACAGCACGGCGTCGCCACGGCCACGGTGT
GTGCTAAGTTTGGAATGGAGTGCACAGTCTACATGGGCGCCGAGGATGTGCGGCGCCAGGCGCTCAACGTCTTCCGCATG
CGCCTTTTGGGTGCAAAGGTCGTGCCCGTTGACGCCGGCTCGCGCACACTGCGTGACGCCGTTAATGAAGCCCTGCGCGC
CTGGGTCGTCCACCTCGACACCACGCACTACATTATCGGCTCTGCCATCGGCCCACATCCTTTTCCGTCCATTGTGCGTA
CATTCCAGTCCGTCATCGGCGACGAGACCAAGGCCCAGTTCCAGGCTGCCCGCGGAAGGCTGCCCGATGCCGTCGTTGCC
TGCGTTGGCGGCGGCTCCAACGCTGTCGGCATGTTCTACCCCTTCTCCCACGACCTCTCTGTTAAGCTGTTGGGTGTCGA
GGCTGGCGGCGACGGTATCGATACCCCTCGCCACGCTGCCACCCTCGCTGGTGGATCTGCAGGCGTCCTGCACGGCGTCC
GCACATACGTGCTGCAGGACAAGAACGGCCAGATCCAGGACACCCACTCCGTCTCTGCCGGCCTCGACTACCCCGGCGTC
GGCCCTGAGCTGGCCAACTGGAAGGACACCGGCCGTGCTCAGTTTATTGCCGCCACCGATGCCCAGGCCCTGCAGGGCTT
CCGCCTGCTGAGCGAGCTTGAGGGCATCATCCCCGCTCTCGAGTCAGCCCACGGCATCTATGGTGCCGTCGAGCTGGCCA
AGACCATGCGGCCTGACCAGGACATTGTTGTCTGCCTCAGCGGCCGTGGCGACAAAGACGTCCAGAGCGTGGCCGACTCC
TTGCCTGAGCTGGGTCCCAAGATTGGCTGGGACCTGCGCTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62