GenePrediction:GLEAN_2236 Details

Name: GLEAN_2236
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1659612..1662719 (+ strand)
Length: 3108
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1659612..1659855 (+ strand)
Length: 244
Type: CDS
Source: GLEAN
Position: GCSC_108:1659884..1660335 (+ strand)
Length: 452
Type: CDS
Source: GLEAN
Position: GCSC_108:1660424..1660552 (+ strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_108:1660605..1661412 (+ strand)
Length: 808
Type: CDS
Source: GLEAN
Position: GCSC_108:1662217..1662357 (+ strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_108:1662658..1662719 (+ strand)
Length: 62
>GLEAN_2236 class=GenePrediction position=GCSC_108:1659612..1662719 (+ strand)
ATGCTGGCAAGGAACCTCTGGACACTGCTCCTCTGTCCTGGACTGGCTGCTGCCGCCGGTCCATTTCTTAAACAGATAAA
CGAGTCTGCCTGGGTATTTGGAAATGATCTATGGAACTTGACACAGGGCCCGGTCTTCGCAAACAAGCTGTTTTACAAGT
CAGAAGACCTCGTAAAATCGTACCTTGGACACTACAGCGGATGGGGCAAGTCAAACTCCGAGGACGTATTATGGCTCGTG
CACAGTACGTGTCTAATAACGTACAACTGCAGATGGCGGAGTGAACAACTTGCGCTGGCTAAATGCCTCGATCGTGGCAC
GCGGTTCTGACTGGGCCGATATCAGCTTCACGTCTGAGCAAGGCGATCTTCATTGGGTCGTCTTTGAAGACTTGGCGGGT
GCTTACCAGTACTTCACCAACCGTGCCCTAGAAGCTGTACAGATCTGGAGAACAGTCTGGCAGCTCGACCCGACCATTTT
TCTTAACGGCCGAACAAACATCAAAGACCAAGCGCTGCCGGATTTTTCCCTTTATACCAACGCGACAAAAGTCCAGGATG
AGACTTTCTTGCTCGCTGACGGCACCTACCTCACAAAATATGACTTTGCTGACTTCGTCCGCGACCGTGACTTCCACGGA
GTCTATGGGCCTGATTTTGGATCTTGGTACATTCACCCCTCATATGAATCGTGGTCATCCAACCAGCTGAGCCAGGGCCT
AACGGTAGGTTGATGACGAAATCCAGCGACTGGCGTGGACTAAATCCATTGTACACAAGATTTTTACTAACTTGACTTCT
GCTAATTGCCAGGTCCACCGTGAATCATCTGTGGGTTCTGCTGTACAGCTGAATGTTATCCAAGACACCTCCCATTTTCG
AGTGACCACGCTTCAACAGCCAGCATCTGGCAAGATATTTGGTCCCTGGCTTTGGTACTTGGTTGGTTACTTCTGCATCT
TATCGTTTGTTCCATAGCTAATAAGTAATCCAGAATAACGGATCGGTCAAAGATGCCAAAAAGCGGCAAGAGCAAGAGGG
TTTCCGCTTTCCCTATAGCTGGTTTAACAACTCCGCCTATCAGTCAAGAGGAGAGGTGGCTGGCTCGCTGCGACTCTCTG
ATGGACGGCCCGCCTCTGGTGCTTCCGTGTTTCTCGGTGATACAAACACAACGACACAGCCGATTGTTCAGGGCATCAAC
TACTATTACACAACCACCACGGATGAATCCGGCTACTTCCGGATCCCTAACGTCCGCACCGGCAGGTATGAACTTTATGC
GTGGTCCAACGGCGGCGTCCTCTACAACGTCTACACCAACGTGACGTGCACCGACGTCACTGTTGCCAAGGACAAACTGG
CGGAGCTTGGAAACATTACGTGGGATGTCCCGAAGGGCCGATCGACTCTCTTCCAAATTGGCGACTTTGACCGGAAGGCA
TACGGGTTCAGGAACGGTGGTCTGCCGTATCAACACGGCCTCTCGGACAAGAGCCCTGCAAATCTAACCTACACTGTCGG
CAGGTCCAACGTGTCGGACTGGTACTATGCCCAATCTGCAAATGGTACCTGGACCATCGAGTTCGACGGTGGTGGCGTCA
GCGAGGGCAATGCAATCCTCAGTGTATCCCTCGCAGGGCACTCTAAAGGTCCATCGCTAGTCATTGATATCAACGGACAG
CGGCTCGATACACTGACACCGAAGAAGTTGGCAAACGACGCGGCGTTGTACCGCTCGGGAAGAGTTTCCGGCGAGTGGCG
ATTCCTTCAATACAACATCACTAGTGATCAGTTATACTCCGGTAAGAACACCATAGGGTTTACTTTGTCCAACTCTGTCC
GATGGAGAGGGTATCTTTGGGACAGTGTGATTCTAGAGCGGGAAGTATAAAGTCAATAAACGGAAGGGGTTGTCGTTGGA
GTTATGGGCTAGAATAAAAACTTAAGAGCTATTGAGAGCGGAGGTAAGGTGAGGCCTCTGCTCGAACCAACAACACAACA
CACACACCTACCAACACATGTAACTGTGCACGAAGAGAGGTTCCGTAAGGTACCTCCCTTCGTCAGAAGGTAGGGCAGTA
TGTGGCTGGTCCGAAGGGAAAAGGGAGGAAAGCCATGCGGGCTCATCCTAGGATCCCGAAAGAGATGACAAGACGAGCCC
GCCCGGCGAGGTCTTTGGCGGTGTTTACTTCACAAGTGCACTGCGTATATGTCTTCGTAACTGATGAATTGCGTGCATGC
GTGCGTGTCTGCTTGTCTGTCCCTCTCTTAAGGAGAGGGAAGAAGAGAGGGTTTTTATATACATAGAGTGTGTAAGTGGC
ATGAATTGTCCCACATCTGATTGGTTAGGAAAAATGGAGTCGGTCACGTGATGATATAGCATCCCGCGAGGGGTCTTGAC
TTGTCATCCTGTGCGGCCAGAATAGGTGATCTTGGGGGTGCACTTCTCTTATTACTCACTATAAAGATGCAGCTAGAAGC
CCTCAATTCGATACTAGAGGAATGAAAAAAGCAGTACAATTTTAAGGGGCGTATCTAGGGTCGGGTGGCTTTGCTTTTGT
TCAATAAACAGTGGATTCATCTCTACATTAACTTGTCACCAACAGGCATCCACGAGCAAAGCTGCGGTGGTATTCACCTG
TACCTGTTGGCACCACACACGCCGCTCGTATCAGCGACAGAGTGCATGATAGACGAAGACGAAGCATTTCTAAAGAAGTT
CATCATGGTTGATTCAAACGGTCAAGGTAAGAAGAACGAACAGAGAGAAAAGAAGGTATGTGGTACCTTGTAATTGCGAA
GACGTCACGTAGTTTGTGTTTGGAGTCGCACGAGGAGAAGAGGTTCACCCGACGATACCTATACTTAGGAGACAAAAAAA
CAAGAGTTTAAGATTTACCAGTTGATTAGTTGATTTGATGATTAGTAAAAAGAATAATAATAAAAACTCTATCTTGGTTA
AGTCGATGTATACTTTTTATTTACAGTAGAAACGTCCCTTTTTAATAGATATCGACTTTCGAATTTCTAACATATCTACT
CCGTAGACATCTTCTACATAGAAAATAGCAATAACATGCGGTTCGTAGGGCCAGAACCCGCCTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62