GenePrediction:GLEAN_2237 Details

Name: GLEAN_2237
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1670464..1670879 (+ strand)
Length: 416
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1670464..1670607 (+ strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_108:1670661..1670879 (+ strand)
Length: 219
>GLEAN_2237 class=GenePrediction position=GCSC_108:1670464..1670879 (+ strand)
ATGGCCGGCCTCTTCTTCTGGCGCGTAGGCGCCCTGTATGGTGCGACAGCCGTGGCGATGGGCGCCTTTGGGGCACACGG
CCTGAAAAAACATATCACCGATCCGCGGAAGCTCAACAGCTGGTCCACGGCCGCCCACTACCAGGTGCGAGATCCATGTA
TTCCCTTCTGGGTCCGCTCTCCTGACTGACGTCACAGCTCGCTCACTCGGTTGCTTTATTGGTGGCGCATGGCCATCCTG
TGGCTGGCTCGCTCTTTACGGCCGGCATGACCTTGTTCAGCGGCAGTATCTATGCCCTAACGCTCGATCCCGAGCGCTTT
AAGTGGATGGGGCCCGTGACGCCCGTCGGTGGACTGTGCTTTATCCTCGGGTGGCTTTCACTGATCTTTAGCCGTGGTGC
CGTCCTGCGCATTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62